Search Strains

sEx12803 [rCes Y18D10A.6a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sIs12803 [rCesY18D10A.6a::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sIs13113 [rCesY110A7A.20::GFP + pCeh361]. Rescued dpy-5 (WT gross phenotype) with GFP expression in all stages. Array transmission is greater than 99.5% (segregates less than 0.5% Dpys). Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx13412 [rCes Y105E8A.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx13672 [rCesY105E8A.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx13726 [rCes Y111B2A.18::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx13727 [rCes y113g7b.17::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx13757 [rCes Y18D10A.6b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx13840 [rCes Y119D3B.14::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx13865 [rCesY17G9B.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14121[rCesY116A8C.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14395 [rCesY17G7B.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14402 [rCes Y102A11A.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14437 [rCes Y18H1A.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14685 [rCesY110A7A.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14899 [rCes Y108G3AL.2::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14909 [rCes Y119C1B.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx15005 [rCesY111B2A.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx15241 [rCes Y110A7A.9::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx15356 [rCesY110A2AL.13::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx16336 [rCesY116A8C.35::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx16340 [rCes Y106G6H.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

1450 bp deletion. Deletion removes 245 bp of promoter, 1st exon and 2nd exon.

989bp deletion. Primers used: RB1537 (external left): CAAGCTTAATTTGCACACAATGCGTCAG; RB1540 (external right): AGAAGAGGCAAGAATGGAACTTGTGCG; RB1538 (internal left): AACAATTTCCGCTTATTTTCAGCGTTTG; RB1539 (internal right): CTGAACCATTGAAAGCTTTTCAGATC. Deletion breakpoints (T09B4 coordinates): 32756/33746 through 32757/33747.

Suppressor of Egl of sel-12.

eGFP tag inserted into the endogenous endu-2 locus. Reference: Qi W, et al. (2020) A secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans. BioRxiv. doi: 10.1101/2020.12.04.408260. Accepted by Nature Communications.

Heterozygotes are slow growing with WT phenotype. Hets segregate more slow growing WT, embryonic lethals (ozDf1/ozDf1) and DpyUncs which are sick and have a maternal effect lethal (none of the offspring from the DpyUncs survive to reproduce). Maintain by picking WT.

Wild type hermaphrodites and males which produce WT, Dpy, Unc and DpyUnc progeny due to mating or loss of the duplication. Pick WT hermaphrodites and males to maintain.

Paralyzed Unc. This strain carries a tightly linked mutation, che-3(ky1018), that changes Q1107 of che-3 to a stop codon. Reference: Larsch, et al. (2015) Cell Reports.

Obligate XO hermaphrodite. Low fertility, segregating many dead XX and nullo-X zygotes. Double mutant combining two null or near-null mutations. Reference: van den Berg MCW, et al. Genetics. 2006 Jun;173(2):677-83. doi: 10.1534/genetics.106.056093. PMID: 16582430.

Skiddy, bleach-sensitive, Bus (resistant to infection by M. nematophilum), resistant to Leucobacter Verde2 and to Leucobacter Verde1. Missense mutation in Y11D7A.9. Reference: O'Rourke et al (in preparation).

umnIs19 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type GFP+; animals that have lost the Dup are Dpy Unc GFP-. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9.

umnIs50 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)]. Animals with the Dup are wild-type mKate2+; animals that have lost the Dup are Dpy Unc mKate2-. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into yDp1 duplication in parental strain TY156 using CRISPR/Cas9.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.

knu858 is a Y146C point mutation representative of a patient mutation associated with MPSIIIB disease. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.

diac-.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Posteriorly displaced nerve ring axons. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Posteriorly displaced nerve ring axons. This strain may contain lin-15(n765) X. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Nose touch defective (recessive). Mechanosensory defective (semi-dominant). Mildly Dpy (ts).

sax-3 mutants have an anteriorly-displaced nerve ring, defects in axon guidance to the ventral midline, and extra axon crossing at the ventral midline. There are also defects in CAN and HSN cell migration, a notched head and an Egl phenotype. This allele is 80% lethal in embryonic stages. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Amphid axon guidence defect. HSN axon guidence defect. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Amplify with the following external primers: EL1(agtcctgaacggagctttga); ER1(tacaatggcagcagcaagtc). Then re-amplify with the nested primer set: IL1(tcgcacattggtttgttgtt); IR1(aacggcatgagttagccaat).

Sqt phenotype. The daf-16(mg255) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg255 is a nonsense mutation Try144Amb.

muIs32 [mec-7p::GFP + lin-15(+)]. Egl, semi-Sterile, embryonic & larval lethality. Lethal in trans to Df. Defective fusion of anchor cell to uterine seam. Maintain under normal conditions. Reference: Choi J, et al., Dev Biol. 2006 Sep 1;297(1):87-102.

Deficiency covers at least all of cosmid T23G4; right breakpoint may be in cosmid C47A4. Fails to complement tlp-1(bx85). Viable and fertile. Although hermaphrodites appear WT in other ways, there are some problems with T cell lineages (affecting the phasmids) and tail cell fusions. Variably Dyf. Male tail tip morphogenesis is also defective, resulting in blobby, "leptoderan" tails. Males are infertile due to an inability to properly copulate.

spr-5(by134) suppresses acy-4(ok1806) sterility. Reference: Kim S, et al. 2012 Genetics

Y102F5A.1. Deletion extents determined by oligo array CGH. Deletion size: ~14kb. Deletion left flank: GGCAATCCTGGCCGAAGCTTTGAAACGCCCGAGTAAAGCCAAGAAGCGTC. Deletion right flank: GTTGTCTTTATCGAACCGCGTTGTTGAACTGTTGCATGAATCATGATTTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.