Search Strains

raEx204 [T05G5.1p::Y113G7B.17(cDNA)::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

raEx215 [T05G5.1p::Y15E3A.4(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

raEx248 [T05G5.1p::Y105E8A.3(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

raEx273 [T05G5.1p::Y17G7B.7(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

raEx275 [T05G5.1p::Y106G6A.1(cDNA)::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.

syIs80 [(pPGF11.13) lin-11::GFP + unc-119(+)] III. Animals are Unc. GFP fluorescence is observed in vulval cells, uterine pi cells and VC neurons.

oxTi993 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + PuroR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:25.92). Insertion into Y105E8B.7. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with puromycin selection.

jy110 is a CRISPR-engineered deletion removing the entire drh-1 coding sequence. Susceptible to viral infection. Defective in inducing the intracellular pathogen response upon viral infection. Reference: Sowa JN, et al. J Virol. 2020 Jan 6;94(2):e01173-19. doi: 10.1128/JVI.01173-19. PMID: 31619561.

Full CRISPR deletion of fbxa-75 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.

Full CRISPR deletion of fbxa-158 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.

Chemosensory, mechanosensory, and osmosensory defects.

Break points: In(ile-1 Y18D10A.2 In(dnj-27 dkf-1)) I. Covered region (Mb) 4 (9.6..13.6) Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(ile-1 Y18D10A.2 In(dnj-27 dkf-1)) I. Covered region (Mb) 4 (9.6..13.6) Balancer marked with myo-2p::Venus. Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(Y102A11A.6 R09F10.1 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2..8.5) Balancer marked with myo-2p::Venus. Lon Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(Y102A11A.6 R09F10.1 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2..8.5) Lon Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(Y102A11A.6 R09F10.1 In(lon-2 mec-10)) X. Covered region (Mb) 6.4 (2..8.5) Balancer marked with myo-2p::mCherry. Lon Mec. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(ile-1 Y18D10A.2 In(dnj-27 dkf-1)) I. Covered region (Mb) 4 (9.6..13.6) Unc. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

osEx108 [(pAY105) let-19::GFP + rol-6(su1006)]. Rollers. Pick rollers to maintain. Reference: Yoda et al. Development (2005) vol. 132 (8) pp. 1885-93.

Maintain at 15C. Temperature-sensitive: slow growth rate, reduced brood size. Resistant to Cry proteins. Isolated from EMS screen in N2 background. Reference: Kim YM, et al. PLoS Pathog. 2024 Oct 18;20(10):e1012611. doi: 10.1371/journal.ppat.1012611. PMID: 39423230.

Heterozygotes are WT and GFP+. mIn1 homozygotes are Dpy and GFP+. vab-1; sax-3 homozygotes are synthetic lethal.

quEx102[F25B3.3::SAX-3 + odr-1::RFP]. F25B3.3::SAX-3 partially rescues the lethality and notch phenotype of sax-3(ky123). Maintain by picking RFP+.

quEx100 [ajm-1::sax-3 + odr-1::RFP]. ajm-1::sax-3 partially rescues the lethality of sax-3(ky123). Maintain by picking RFP+.

quEx99 [sax-3(minigene) + odr-1::RFP]. Rescues the lethality of ky123. Pick RFP+ to maintain.

quEx168 [sax-3::GFP + odr-1::RFP]. Pick RFP+ to maintain. GFP is visible at higher magnification but fades quickly. Strongest GFP is in the head region. The Chin-Sang Lab recommends researchers use this strain instead of IC450, as sax-3::GFP expression in IC699 is more consistent than in the comparable strain IC450.

Mos1 transposon insertion: frP6: F39H12 (at position 19268) acacctggtaAGCATAGGGCTAGGCCTTAGACTTTATATT, and frP7: Y10G11A (at position 1294) acacctggtaAAACAATTTCCAAGTAAAAAAATCATGTATT. Mos1 sequence is in lowercase.

Homozygous viable. Deletion of 1493 bp in parental strain N2. Left flanking sequence: attaatttttgaatttcctaca; Right flanking sequence: tgacgggctaatattgaatta. sgRNA #1: attacactataataatgtgt; sgRNA #2: aaacgacaaactcattatga.

Locomotion and feeding defects. Triple mutant lacks all muscarinic signalling. Reference: Steger KA & Avery L. Genetics. 2004 Jun;167(2):633-43.

Downregulation of tph-1::GFP expression in the ADF neurons. CORRECTION: The yz6 allele had been erroneously listed as y26 in our database.

Superficially WT. by108 completely suppresses the Egl defect of sel-12 mutants. by108 derepresses the transcription of hop-1 in the early larval stages. This strain may not be used for commercial purposes.

Hypersensitive to hypoxia. Deletion corresponds to base pairs 13056-13629 in the published F08B12 sequence (genebank accession # Z68104).

Hypersensitive to hypoxia. Deletion corresponds to base pairs 13009-13380 in the published F08B12 sequence (genebank accession # Z68104).

Temperature sensitive Egl and Unc. 318 pb deletion including exons 6 and 7. Possibly an allele of exp-3.

A deletion in F22B7.7 corresponding to base pairs #9512-9815 in the published C. elegans cosmid F22B7 sequence (Genbank accession #L120180. Predicted protein F22B7.7 is part of a family of 2-pore domain potassium channels.

A 1215 bp deletion in C40C9.1 corresponding to base pairs #9009-10223 in the published C. elegans cosmid C40C9 sequence (Genbank accession #Z70266).

A 150 bp deletion in F44A2.2 corresponding to base pairs #27451-27600 in the published C. elegans cosmid F44A2 sequence (Genbank accession #U41993). The predicted protein F44A2.2 is called "nshab1", which is homologous to potassium voltage-gated channel subfamily B, member 2.

Heterozygotes are WT and segregate WT, Dpys and lethals.

Heterozygotes are WT and segregate WT, Uncs, Ste/Mel, and dead eggs. The epc-1(n4076) deletion removes 886 nucleotides from the epc-1 locus (Y111B2A.11). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 2014 and ends at about nt. 2899 to give the junction sequence CTTCTCTGT/CCGGCTTTA.

Heterozygotes are WT and segregate WT, Unc, Ste/Mel, and dead eggs. ssl-1(n4077) deletion removes 683 nucleotides from the ssl-1 locus (Y111B2A.23). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 5075 and ends at about nt. 5757 to give the junction sequence GATATACAC/AGACCTAAT.

1.986 kb deletion in Y113g7A.5 encoding ligand-gated chloride channel. Homozygous viable.

Natural isolate; obtained in July 2002 from compost heap in Roxel, Münster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype "EU3". For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Natural isolate; obtained in July 2002 from compost heap in Roxel, Münster, North-West Germany; frozen within 5 generations after isolation; microsatellite genotype "EU3". For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Natural isolate. Obtained in July 2002 from a compost heap in Roxel, Munster, Northwest Germany. Frozen within 5 generations after isolation. Microsatellite genotype "EU5". For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Natural isolate. Obtained in July 2002 from a compost heap in Roxel, Munster, Northwest Germany. Frozen within 5 generations after isolation. Microsatellite genotype "EU3". For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Natural isolate. Obtained in September 2002 from a compost heap in Mecklenbeck, Munster, Northwest Germany. Frozen within 5 generations after isolation. Microsatellite genotype "EU2". For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Natural isolate. Obtained in September 2002 from a compost heap in Mecklenbeck, Munster, Northwest Germany. Frozen within 5 generations after isolation. Microsatellite genotype "EU2". For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Natural isolate. Obtained in September 2002 from a compost heap in Mecklenbeck, Munster, Northwest Germany. Frozen within 5 generations after isolation. Microsatellite genotype "EU6". For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Natural isolate. Obtained in October 2002 from a compost heap in Roxel, Munster, Northwest Germany. Frozen within 5 generations after isolation. Microsatellite genotype "EU5". For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Natural isolate. Obtained in October 2002 from a compost heap in Roxel, Munster, Northwest Germany. Frozen within 5 generations after isolation. Microsatellite genotype "EU4". For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Natural isolate. Obtained in October 2002 from a compost heap in Roxel, Munster, Northwest Germany. Frozen within 5 generations after isolation. Microsatellite genotype "EU3". For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).