Strain Information
| Name | CY121 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | ucp-4(ok195) V. |
| Description | Amplify with the following external primers: EL1(agtcctgaacggagctttga); ER1(tacaatggcagcagcaagtc). Then re-amplify with the nested primer set: IL1(tcgcacattggtttgttgtt); IR1(aacggcatgagttagccaat). |
| Mutagen | UV/TMP |
| Outcrossed | x5 |
| Made by | C Wolkow |
| Laboratory | CY |
Sign in
or
register an account if you want to order this strain.