Go to the U of M home page

Caenorhabditis Genetics Center (CGC)

    • Sign In

    Strain Information

    Name CY121   View On Wormbase
    Species C. elegans
    Genotypeucp-4(ok195) V.
    DescriptionAmplify with the following external primers: EL1(agtcctgaacggagctttga); ER1(tacaatggcagcagcaagtc). Then re-amplify with the nested primer set: IL1(tcgcacattggtttgttgtt); IR1(aacggcatgagttagccaat).
    MutagenUV/TMP
    Outcrossedx5
    Made byC Wolkow
    Laboratory CY
    Sign in or register an account if you want to order this strain.
    • CGC Home
    • Search Strains
    • Register
      (existing labs)
    • Request a Lab Code
      (new labs)
    • Strain List
      • Recently Added Strains
      • Endogenously-tagged Loci
      • Wild Isolates
        (Caenorhabditis sp.)
      • Wild Isolates
        (non-Caenorhabditis sp.)
      • Strain List (text file)
    • Strain Donation
    • Lab List
    • Acknowledging the CGC
    • Contact
    • Frequently Asked Questions (FAQs)
    • Conditions Of Use

    • What Is C. elegans?
    • Nomenclature

    • CeNDR - the C. elegans Natural Diversity Resource
    • WormAtlas
    • WormBase
    • National Bioresource Project for the Experimental Animal
      C. elegans
    • WormBuilder
    • WormBook
    • WormBook in Genetics