| CY121 |
C. elegans |
ucp-4(ok195) V. Show Description
Amplify with the following external primers: EL1(agtcctgaacggagctttga); ER1(tacaatggcagcagcaagtc). Then re-amplify with the nested primer set: IL1(tcgcacattggtttgttgtt); IR1(aacggcatgagttagccaat).
|
|
| RB695 |
C. elegans |
ucp-4(ok195) V. Show Description
K07B1.3. Homozygous. Outer Left Sequence: AGTCCTGAACGGAGCTTTGA. Outer Right Sequence: TACAATGGCAGCAGCAAGTC. Inner Left Sequence: TCGCACATTGGTTTGTTGTT. Inner Right Sequence: AACGGCATGAGTTAGCCAAT. Inner primer WT PCR product: 2995. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| SD1658 |
C. elegans |
unc-119(ed3) III; gaEx192. Show Description
gaEx192 [sod-3p::mCherry + ucp-4p::ucp2(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.
|
|
| SD1901 |
C. elegans |
unc-119(ed3) III; gaEx214. Show Description
gaEx214 [sod-3p::mCherry + aakg-2(sta2) + ucp-4p::ucp2(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.
|
|
| SD1903 |
C. elegans |
unc-119(ed3) III; gaEx218. Show Description
gaEx218 [sod-3p::mCherry + aakg-2(sta2) + lys-1p::lyz(D. rerio) + ucp-4p::ucp2(D. rerio) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.
|
|
| SD1905 |
C. elegans |
unc-119(ed3) III; gaEx223. Show Description
gaEx223 [sod-3p::mCherry + aakg-2(sta2) + ucp-4p::ucp2(D. rerio) + hsf-1(+) + lys-1p::lyz(D. rario) + unc-119(+)]. Reference: Sagi D & Kim SK. PLoS Genet. 2012 Jun;8(6):e1002780.
|
|