Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CL208 C. elegans srf-9(dv4) him-5(e1490) V. Show Description
Animals are somewhat smaller than WT and commonly have a protruding vulva. Unc(slow moving and non-sinusoidal body posture). Egl. Ectopic surface binding of the lectins WGA and SBA. Males are infertile and Mab.
CL2120 C. elegans dvIs14. Show Description
dvIs14 [(pCL12) unc-54::beta 1-42 + (pCL26) mtl-2::GFP]. mtl-2::GFP produces strong constitutive intestinal expression of GFP at all developmental stages. Expresses human AB peptide and accumulates B-amyloid fibrils. AB toxicity enhanced at higher temperatures.
CL2355 C. elegans smg-1(cc546) dvIs50 I. Show Description
dvIs50 [pCL45 (snb-1::Abeta 1-42::3' UTR(long) + mtl-2::GFP] I. Maintain at 16C. Pan-neuronal expresion of human Abeta peptide. Constitutive intestinal expression of GFP from marker transgene. Strain shows deficits in chemotaxis, associative learning, and thrashing in liquid. Strain also has incomplete sterility due to germline proliferation defects and embryonic lethality. Maintain at 16 C to reduce selection against transgene, although this does not alter the partial sterility. Reference: Wu Y., et al. J Neurosci. 2006 Dec 13;26(50):13102-13. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CL264 C. elegans srf-8(dv38) V. Show Description
Animals are somewhat smaller than WT. Often have protuding vulva. Unc(slow moving and non-sinusoidal body posture). Egl. Males are infertile and Mab. Ectopic surface binding of lectins WGA and SBA.
CL6049 C. elegans dvIs62 X. Show Description
dvIs62 [snb-1p::hTDP-43/3' long UTR + mtl-2p::GFP] X. Temperature-sensitive. Maintain at 16 to minimize selection against transgene. Uncoordinated from hatching; phenotype is stronger at higher temperatures. Intestinal GFP expression. Reference: Ash PE, et al. Hum Mol Genet. 2010 Aug 15;19(16):3206-18.
CLP1445 C. elegans pmp-4(twn16) IV; twnEx656. Show Description
twnEx656 [pmp-4p::pmp-4 + elt-2p::GFP]. Pick GFP+ animals to maintain. Superficially wild-type. twnEx656 contains 1.2 kb pmp-4 promoter driving expression of 2.2 kb pmp-4 cDNA; transgene rescues behavioral phenotype of twn16 mutants. twn16 is a 1651 bp deletion removing 1027 bp of the promoter sequence, the transcriptional start site, and the first two exons of pmp-4. twn16 has been out-crossed 3 times in this strain. Reference: Tsai SH, et al. Cell Rep. 2024 Mar 22;43(4):113996. doi: 10.1016/j.celrep.2024.113996. PMID: 38520690.
COP1622 C. elegans nas-38(knu568) X. Show Description
Increased movement quiescence during lethargus. knu568 is a specific in-frame deletion of the TSP1 domain. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
COP1626 C. elegans ins-34(knu572) IV. Show Description
F52B11.6. Superficially wild-type. knu572 is an F125L point mutation mimicking human mutation F119L in patients with PMM2 deficiency disease. Strain is sensitive to bortezomib (proteasome blocker) and displays larval arrest in liquid culture. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.
COP1635 C. elegans nas-38(knu579 ok3407) X. Show Description
Specific in-frame deletion of the astacin domain in ok3407 background suppresses increased quiescence from the ok3407 allele. Quiescence behavior in this strain is reverted to wild-type. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
COP1879 C. elegans unc-68(knu765) V. Show Description
The UNC-68a G350R missense mutation (knu765) corresponds to a human myopathic variant, RyR1:p.G341R. Subtle effects on locomotion, and altered response to halothane and aldicarb. Reference: Graham B, et al. Front. Genet. 2020; 11:37. doi: 10.3389/fgene.2020.00037 PMID: 32174957
COP1880 C. elegans unc-68(knu766) V. Show Description
The UNC-68a G350R missense mutation (knu766) corresponds to a human myopathic variant, RyR1:p.G341R. Subtle effects on locomotion, and altered response to halothane and aldicarb. This strain replaces COP1879, in which the targeted missense mutation has reportedly reverted back to wild type (AGA codon back to GGA). Reference: Graham B, et al. Front. Genet. 2020; 11:37. doi: 10.3389/fgene.2020.00037 PMID: 32174957
COP1883 C. elegans unc-68(knu769) V. Show Description
The UNC-68a R2246H missense mutation (knu769) corresponds to a human myopathic variant, RyR1:p.R2163H. Subtle effects on locomotion, and altered response to halothane and aldicarb. Reference: Graham B, et al. Front. Genet. 2020; 11:37. doi: 10.3389/fgene.2020.00037 PMID: 32174957
COP1932 C. elegans unc-68(knu810) V. Show Description
The UNC-68a K3675Q missense mutation (knu810) corresponds to a human myopathic variant, RyR1:p.K3452Q. Subtle effects on locomotion, and altered response to halothane and aldicarb. Reference: Graham B, et al. Front. Genet. 2020; 11:37. doi: 10.3389/fgene.2020.00037 PMID: 32174957
COP1944 C. elegans unc-68(knu822) V. Show Description
The UNC-68a R2564H missense mutation (knu822) corresponds to a human myopathic variant, RyR1:p.R2458H. Subtle effects on locomotion, and altered response to halothane and aldicarb. Reference: Graham B, et al. Front. Genet. 2020; 11:37. doi: 10.3389/fgene.2020.00037 PMID: 32174957
COP1947 C. elegans unc-68(knu825) V. Show Description
The UNC-68a R2560H missense mutation (knu825) corresponds to a human myopathic variant, RyR1:p.R2454H. Subtle effects on locomotion, and altered response to halothane and aldicarb. Reference: Graham B, et al. Front. Genet. 2020; 11:37. doi: 10.3389/fgene.2020.00037 PMID: 32174957
COP1950 C. elegans unc-68(knu828) V. Show Description
The UNC-68a R5021H missense mutation (knu769) corresponds to a human myopathic variant, RyR1:p.R4861H. Subtle effects on locomotion, and altered response to halothane and aldicarb. Reference: Graham B, et al. Front. Genet. 2020; 11:37. doi: 10.3389/fgene.2020.00037 PMID: 32174957
COP2002 C. elegans K09E4.4(knu858) II. Show Description
knu858 is a Y146C point mutation representative of a patient mutation associated with MPSIIIB disease. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.
COP262 C. elegans unc-119(ed3) III; knuSi221. Show Description
knuSi221 [fib-1p::fib-1(genomic)::eGFP::fib-1 3' UTR + unc-119(+)]. Single copy insertion. fib-1 promoter, genomic sequence, and 3'UTR was inserted into pCFJ151 (ttTi5606) targeting vector and inserted into ttTi5605. Allen AK, Nesmith JE, and A Golden. 2014 G3:4(12)2329-43.
CP101 C. briggsae Cbr-puf-2(nm66)/Cbr-dpy-?(nm4) II. Show Description
Larval-lethal puf-2 deletion allele. Heterozygotes are WT (slightly Dpy) and segregate 25% Dpy, 50% wild-type heterozygotes, and 25% larval lethal (arrest L1-L2). Maintain by picking WT and checking for correct segregation of progeny. Map distance between nm4 and nm66 has not been preciely determined, but is tight enough that >90% of non-Dpy non-Lva progeny from double-heterozygotes retain the parental genotype. Reference: Liu Q & Haag ES. J Exp Zool. 2013 Part B.
CV6 C. elegans lab-1(tm1791) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are wild-type GFP+. Homozygotes (tm1791/tm1791) are 4% Him with 22% embryonic lethality. Maintain by picking GFP+. Reference: de Carvalho et al., Genes Dev 22, 2869-2885.
CX2565 C. elegans kyIs4 lin-15B&lin-15A(n765) X. Show Description
kyIs4 [ceh-23p::unc-76::GFP + lin-15(+)] X. kyIs4 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX2610 C. elegans lin-15B&lin-15A(n765) kyIs30 X. Show Description
kyIs30 [glr-1::GFP + lin-15(+)]. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3553 C. elegans lin-15B&lin-15A(n765) kyIs104 X. Show Description
kyIs104 [str-1p::GFP] X. AWB expression of GFP.
CX3572 C. elegans kyIs105 V; lin-15B&lin-15A(n765) X. Show Description
kyIs105 [str-3p::snb-1::GFP + lin-15(+)]. Also known as str-3::VAMP::GFP or ASI::VAMP::GFP or M7::VAMP::GFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3596 C. elegans kyIs128 lin-15B&lin-15A(n765) X. Show Description
kyIs128 [str-3::GFP + lin-15(+)]. kyIs128 encodes a translational fusion contaning 4aa coding sequence (M7.13::GFP). Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX3662 C. elegans lin-15B&lin-15A(n765) X; kyIs121. Show Description
kyIs121 [unc-115::GFP + lin-15(+)]; autosomal. Maintain under normal conditions. Reference: Lundquist E, et al. (1998) Neuron 21(2):385-92.
CX3716 C. elegans lin-15B&lin-15A(n765) kyIs141 X. Show Description
kyIs141[osm-9::GFP5 + lin-15(+)]. GFP in sensory neurons.
CX3937 C. elegans lim-4(ky403) X. Show Description
Coily movement; aberrent head movement. The AWB neurons are transformed towards the AWC neuron fate by many criteria.
CX5000 C. elegans slt-1(eh15) X. Show Description
slt-1 mutants have no dissecting-scope phenotype. They have a 40% penetrant defect in the ventral guidance of the AVM neuron scored with mec-4::GFP, a mild defect in CAN cell migration that is enhanced by a ceh-23::GFP transgene, and a mild defect in midline crossing by PVQ neurons scorable with sra-6::GFP. slt-1(eh15) is a complex rearrangement that duplicates the endogenous slt-1 gene, but disrupts both duplicated copies. The two copies are linked on X but the exact distance between them is not known. The duplication probably extends >13 kb based on Southern blotting. Deletion breakpoints for the first copy of slt-1 are as follows: nucleotides 26219 to 28163 and 28197 to 28294 in cosmid C26G2 are deleted. The second copy of slt-1 contains the following structure: nucleotides 28197 to 28294 in C26G2 are deleted, followed by a duplication of nucleotides 28300 to 28396 in C26G2 that begins 5 nucleotides after the deletion. Both copies of slt-1 are mutant, as confirmed by both DNA sequence and RT-PCR analysis of slt-1 mRNA. Scoring for homozygosity of the slt-1 allele by PCR is difficult because of the two copies of the gene and because the small deletion and the small duplication of the second copy of slt-1 are the same size. The mutant can be followed indirectly by X linkage (very closely linked to unc-3). It may be possible to make a specific primer within the duplicated region that detects a unique band in the slt-1 mutant.
CX5478 C. elegans lin-15B&lin-15A(n765) X; kyEx581. Show Description
kyEx581 [ocr-4::GFP + lin-15(+)]. GFP expression in OLQS. Maintain by picking non-Muv.
CX6448 C. elegans gcy-35(ok769) I. Show Description
668 bp deletion in cosmid T04D3. Break points are 31961 and 32629 with respect to T04D3. Sequence at break point: CCTGCTCAATGACCTTTATCTTCGTT/AACGTGGCGAACAAAATGGAATCCAACGGT. Primers for a ~2.4kb band in ok769 and a ~3.1kb band in N2: ok769L 5' CCT GGT ACA GTA TTT AGG CG; 3' ok769R 5' CTT TCA GTC CGT TGA GCT TC 3'.
CX652 C. elegans kyIs235 V; syg-1(ky652) X. Show Description
kyIs235 [unc-86::snb-1::YFP + unc-4p::lin-10::RFP(intron) + odr-1::RFP]. Also known as unc-86::VAMP::YFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CX7102 C. elegans lin-15B&lin-15A(n765) qaIs2241 X. Show Description
qaIs2241 [gcy-36::egl-1 + gcy-35::GFP + lin-15(+)].
CY251 C. elegans sqt-1(sc13) age-1(mg44) II; bvIs2. Show Description
bvIs2 contains [ric-19p::age-1(cDNA)::myc::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs2 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GCA CAG TTT TAC GAA AGG AAC-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.
CY262 C. elegans sqt-1(sc13) age-1(mg44) II; bvIs1. Show Description
bvIs1 contains [ges-1p::age-1(cDNA)::unc-54 3'UTR + mec-7::GFP]. sqt-1(sc13) causes recessive left-handed rollers. bvIs1 rescues mg44 dauer arrest and partially rescues mg44 longevity. Array can be detected by PCR (Fwd: 5'-GTC ATT TTG GCA CCA TAG GAG-3' / Rev: 5'-ACC ATC GTT TGC AGT TGT GG-3'). Reference: Iser WB, Gami MS, Wolkow CA. Dev Biol. 2007 Mar 15;303(2):434-47.
CY397 C. elegans daf-16(mg242) I; sqt-1(sc13) age-1(mg109) II. Show Description
Sqt phenotype. The daf-16(mg242) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg242 is a nonsense mutation Trp220Amb.
CY398 C. elegans daf-16(mg255) I; sqt-1(sc13) age-1(mg109) II. Show Description
Sqt phenotype. The daf-16(mg255) allele is a dominant suppressor of age-1(mg109) daf-c phenotype. mg255 is a nonsense mutation Try144Amb.
CY573 C. elegans bvIs5. Show Description
bvIs5 [cyp-35B1p::GFP + gcy-7p::GFP]. Little or no GFP expression in adults. GFP expressed in intestine of dauers. Reference: Iser WB, et al. PLoS One. 2011 Mar 9;6(3):e17369.
CY577 C. elegans bvIs6. Show Description
bvIs6 [cat-4p::GFP + gcy-7p::GFP]. GFP localized to intestine, neurons and hypodermis in adults. GFP localized to neurons and seam cells in dauers. Reference: Iser WB, et al. PLoS One. 2011 Mar 9;6(3):e17369.
CYA23 C. elegans ahcy-1(syb748) I; sqIs13. Show Description
sqIs13 [lgg-1p::GFP::lgg-1 + odr-1p::RFP]. Pick RFP+/GFP+ animals to maintain. GFP fluorescence in autophagosomes. RFP fluorescence in AWB and AWC. ahcy-1(syb748) is a CRISPR/Cas9-engineered C280A substitution that eliminates electrophile sensing but retains enzymatic activity.
CZ10123 C. elegans rabx-5(qa7800) III. Show Description
rabx-5(qa7800) mutants show decreased protein localization of YFP::RAB-5 in the cell bodies but increased protein localization within the dorsal cord in both synaptic and intersynaptic regions
CZ1072 C. elegans unc-62(e917) V. Show Description
Inversion which may serve as a balancer for the center of LG V. Maternal effect lethal allele which results in 57% embryonic arrest, 40% larval arrest, and 3% which survive to be fertile adults with a variety of defects including Egl, Unc and Vab.
CZ1200 C. elegans juIs76 II; lin-15B&lin-15A(n765) X. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II.
CZ1566 C. elegans lin-15B&lin-15A(n765) juIs109 X. Show Description
juIs109 [efn-4::GFP + lin-15(+)] X. Superficailly wild-type. GFP expression detected under high power in a subset of head neurons, primary vulval cells, and a pair of pharyngeal neurons. Reference: Chin-Sang ID, et al. Development. 2002 Dec;129(23):5499-510.
CZ16518 C. elegans juEx4796. Show Description
juEx4796 [col-19p::mito::GFP + ttx-3p::RFP]. Pick animals with red fluorescence to maintain array. Transgenic animals express mito::GFP in the hypodermis. Reference: Fu H, et al. Nat Commun. 2020 Feb 26;11(1):1050. PMID: 32103012.
CZ1774 C. elegans vab-1(e856) ptp-3(op147)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
mIs14 [myo-2::GFP + pes-10::GFP]. Homozygous lethal double mutant balanced by GFP- and dpy-10-marked inversion. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP homozygous vab-1 ptp-1 double mutants. vab-1 ptp-1 double mutants (non-GFP) are embryonic lethal. Reference: Harrington RJ, et al. Development. 2002 May;129(9):2141-53.
CZ18412 C. elegans juSi94 II; rps-18(ok3353) IV; glo-4(ok623) V; juEx5515. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5515 [unc-25p::GFP1-10 + unc-25p::mCherry::rab-3 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. GABAergic motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in neurons, and GABAergic motor neuron-specific expression of mCherry::rab-3. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ2060 C. elegans juIs137 II. Show Description
juIs137 [flp-13p::snb-1::GFP] II. GFP expression labels synaptic vesicles. Reference: Sakaguchi-Nakashima A, et al. Curr Biol. 2007 Apr 3;17(7):592-8. doi: 10.1016/j.cub.2007.01.074. PMID: 17346966.
CZ22190 C. elegans rpm-1(ok364) rpms-1(ju1285) V. Show Description
ju1285 is a deletion in F07B7.12/rpms-1. Reference: Sun Y, et al. MicroPubl Biol. 2024 Dec 5;2024:10.17912/micropub.biology.001396. doi: 10.17912/micropub.biology.001396. PMID: 39712931.
CZ22695 C. elegans juEx6908. Show Description
juEx6908 [nmr-1p::PH::miniSOG(Q103L) + nmr-1p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Interneuron expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator). Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.