| CF2630 |
C. elegans |
sIs10314. Show Description
sIs10314 [rCesC06B3.4::GFP + pCeh361]. Strain was generated by outcrossing to remove dpy-5 from BC12544. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
|
|
| CF2885 |
C. elegans |
aqp-1(tm2309) II. Show Description
Homozygous viable, but short-lived. Reference: Lee SJ, et al. Cell Metab. 2009 Nov;10(5):379-91.
|
|
| CF2892 |
C. elegans |
sEx10466. Show Description
sEx10466 [nnt-1p::GFP + (pCeh361)dpy-5(+)]. Pick GFP+ animals to maintain. Derived by outcrossing BC10466 2x to wild-type to remove dpy-5(e907). Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
|
|
| CF2893 |
C. elegans |
sEx11128. Show Description
sEx11128 [gpd-2p::GFP + (pCeh361)dpy-5(+)]. Pick GFP+ animals to maintain. Derived by outcrossing BC11128 2x to wild-type to remove dpy-5(e907). Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
|
|
| CF2962 |
C. elegans |
muEx420. Show Description
muEx420 [hsp-12.6p::RFP(NLS) + odr-1p::RFP]. Pick RFP+ animals to maintain. Reference: Zhang P, et al. Cell Metab. 2013 Jan 8;17(1):85-100.
|
|
| CF301 |
C. elegans |
mab-5(e2088) III; unc-31(e169) IV; him-5(e1490) V; muIs9 X. Show Description
muIs9 [hs-mab-5 + C14G10]. Heat-shock inducible mab-5. C14G10 contains a WT copy of unc-31. muIs9 integrated by gamma irradiation.
|
|
| CF311 |
C. elegans |
mab-5(e1239) egl-5(n945) III; him-5(e1490) V. Show Description
|
|
| CF3556 |
C. elegans |
agIs6. Show Description
agIs6 [dod-24p::GFP]. Derived by outcrossing AU68 3 times to the Kenyon lab N2 strain. Reference: Yamawaki TM, et al. PLoS Biol. 2010 Aug 31;8(8). pii: e1000468.
|
|
| CF453 |
C. elegans |
muIs16 II; dpy-20(e1282) IV. Show Description
muIs16 [mab-5::GFP + dpy-20(+)]. non-Dpy.
|
|
| CF4601 |
C. elegans |
muIs252 II; unc-119(ed3) III; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4611 |
C. elegans |
muIs257 I; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4610. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4614 |
C. elegans |
muIs252 II; tbb-2(muIs260[wrmScarlet11::tbb-2]) unc-119(ed3) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11 inserted at the N-terminus of the endogenous tbb-2 locus; detectable in all somatic tissues where wrmScarlet1-10 is present. Figure 3B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
|
|
| CF4625 |
C. elegans |
muIs252 II; unc-119(ed3) III; tomm-20(muIs276[tomm-20::wrmScarlet11(MDELYK)]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11(MDELYK) inserted at the C-terminus of the endogenous TOMM-20 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure S6B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
|
|
| CF4639 |
C. elegans |
glh-1(sam140[glh-1::T2A::wrmScarlet(1-10)]) I; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
fib-1(mu498[wrmScarlet11::fib-1]) generated via CRISPR/Cas9 insertion into parental strain DUP237; transgene contains a linker between wrmScarlet11 and fib-1. Endogenous fib-1 detectable in the germline. T2A::wrmScarlet(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates wrmScarlet(1-10) from GLH-1 post-translationally so that wrmScarlet(1-10) disperses throughout germ cell nuclei and cytoplasm. wrmScarlet(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249. Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
|
|
| CF491 |
C. elegans |
pry-1(mu38) I; him-5(e1490) V. Show Description
Very sick, Muv, Scrawny. Extra rays in males in body. Ectopic expression of lin-39, mab-5, egl-5. Cold sensitive - grows better at 25C.
|
|
| CF65 |
C. elegans |
mab-5(e2088) III; lin-22(n372) IV; him-5(e1490) V. Show Description
mab-5 mutation affects ectodermal and mesodermal lineages. lin-22 and him-5 mutations affect neuroblast formation from the epidermal precursor cell V5.
|
|
| CF80 |
C. elegans |
mab-3(mu15) II; him-5(e1490) V. Show Description
Abnormal V rays (male).
|
|
| CFB2252 |
C. brenneri |
Caenorhabditis brenneri. Show Description
Male-female strain. Caenorhabditis brenneri reference genome. 107 generations of full-sib mating.
|
|
| CGC1 |
C. elegans |
C. elegans wild isolate. Show Description
CGC1 (formerly known as PD1074) is intended to be used as a wild-type reference strain with the closely matched genome assembly of Yoshimura, et al. (Genome Res. 2019 Jun;29(6):1009-1022) available on Wormbase as VC2010-1.0. (ENA study accession PRJEB28388; assembly accession GCA_900538205). CGC1 is a defined and recently cloned population of animals derived from the original "Bristol" variant of C. elegans originally obtained by Brenner from E. Dougherty with no known history of mutagenesis. Brenner's original population, called N2, was used as the basis for the vast majority of laboratory strains in use currently. No early frozen stock of the unmutagenized N2 population currently exists, but later stocks were available from several laboratories. CGC1 is a clonal population founded by picking a single worm of one such stock, VC3510. VC3510 in turn derives from a subpopulation of N2 described in the literature as VC2010. We note that CGC1 is expected to be largely similar to most lab N2 strains, but that as a clonal isolate derived from N2, there will be some loci that will vary compared to any other particular N2 isolate. One such example is a partial deletion of the alh-2 locus in CGC1. Additional loci that were found to vary between the prior N2 reference genome (WormBase release WS264) and the VC2010-1.0 assembly are detailed in supplemental table 8 in Yoshimura, et al, (2019). For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| CGC185 |
C. elegans |
dlg-1(umn90[dlg-1::GFP(S65C)-C1::3xFlag]) X. Show Description
Insertion of GFP(S65C) at the C-terminal end of dlg-1 by CRISPR/Cas9. GFP(S65C)-C1 is from plasmid pDD372 of Goldstein Lab Sap Trap-SEC kit. dlg-1 guide: TAATGACGTGGCACCCAAAT.
|
|
| CGC186 |
C. elegans |
dlg-1(umn91[dlg-1::GFP(S65C)-C1::3xFlag]) X. Show Description
Insertion of GFP(S65C) at the C-terminal end of dlg-1 by CRISPR/Cas9. GFP(S65C)-C1 is from plasmid pDD372 of Goldstein Lab Sap Trap-SEC kit. dlg-1 guide: TAATGACGTGGCACCCAAAT.
|
|
| CGC187 |
C. elegans |
dlg-1(umn92[dlg-1::GFP(S65C)-C1::3xFlag]) X. Show Description
Insertion of GFP(S65C) at the C-terminal end of dlg-1 by CRISPR/Cas9. GFP(S65C)-C1 is from plasmid pDD372 of Goldstein Lab Sap Trap-SEC kit. dlg-1 guide: TAATGACGTGGCACCCAAAT.
|
|
| CGC195 |
C. elegans |
his-72(umn99[his-72::GFP(S65C)-C1::3xFlag]) III. Show Description
Insertion of 3xGAS-linker::GFP(S65C)::3xFlag at the C-terminal end of his-72 by CRISPR/Cas9. GFP(S65C)-C1 is from plasmid pDD372 of Goldstein Lab Sap Trap-SEC kit. his-72 guide: GAGCTTAAGCACGTTCTCCG.
|
|
| CGC196 |
C. elegans |
his-72(umn100[his-72::GFP(S65C)-C1::3xFlag]) III. Show Description
Insertion of 3xGAS-linker::GFP(S65C)::3xFlag at the C-terminal end of his-72 by CRISPR/Cas9. GFP(S65C)-C1 is from plasmid pDD372 of Goldstein Lab Sap Trap-SEC kit. his-72 guide: GAGCTTAAGCACGTTCTCCG.
|
|
| CGC197 |
C. elegans |
his-72(umn101[his-72::GFP(S65C)-C1::3xFlag]) III. Show Description
Insertion of 3xGAS-linker::GFP(S65C)::3xFlag at the C-terminal end of his-72 by CRISPR/Cas9. GFP(S65C)-C1 is from plasmid pDD372 of Goldstein Lab Sap Trap-SEC kit. his-72 guide: GAGCTTAAGCACGTTCTCCG.
|
|
| CGC204 |
C. elegans |
dlg-1(umn108[dlg-1::mKate2-C1::3xFlag]) X. Show Description
Insertion of 3xGAS-linker::mKate2::3xFlag at the C-terminal end of dlg-1 by CRISPR/Cas9. mKate2-C1 is from plasmid pDD375 of Goldstein Lab Sap Trap-SEC kit. dlg-1 guide: TAATGACGTGGCACCCAAAT.
|
|
| CGC205 |
C. elegans |
dlg-1(umn109[dlg-1::mKate2-C1::3xFlag]) X. Show Description
Insertion of 3xGAS-linker::mKate2::3xFlag at the C-terminal end of dlg-1 by CRISPR/Cas9. mKate2-C1 is from plasmid pDD375 of Goldstein Lab Sap Trap-SEC kit. dlg-1 guide: TAATGACGTGGCACCCAAAT.
|
|
| CGC206 |
C. elegans |
dlg-1(umn110[dlg-1::mKate2-C1::3xFlag]) X. Show Description
Insertion of 3xGAS-linker::mKate2::3xFlag at the C-terminal end of dlg-1 by CRISPR/Cas9. mKate2-C1 is from plasmid pDD375 of Goldstein Lab Sap Trap-SEC kit. dlg-1 guide: TAATGACGTGGCACCCAAAT.
|
|
| CGC83 |
C. elegans |
tmIn8 [umnIs64] II. Show Description
umnIs64 [myo-2p::GFP + NeoR, II:12833878 (intergenic)] II. tmIn8 is a CRISPR/Cas9-induced inversion between F13D12.6 and cup-14 in LG II covering region (Mb) 2.1 (11.7..13.9). Derived by insertion of myo-2p::GFP transgene into parental strain FX19134 using CRISPR/Cas9.
|
|
| CGC87 |
C. elegans |
tmIn54 [umnIs69] V. Show Description
umnIs69 [myo-2p::GFP + NeoR, V:4308261(intergenic)] V. Break points: In(srbc-66 T10H9.8) V. Covered region (Mb) 3.1 (3.5..6.7). Derived by insertion of myo-2p::GFP transgene into parental strain FX19702 using CRISPR/Cas9.
|
|
| CGC88 |
C. elegans |
tmIn26 [umnIs70] X. Show Description
umnIs70 [myo-2p::GFP + NeoR, X:6745526(intergenic)] X. tmIn26 homozygotes are Lon and Mec. Break points: In(lon-2 mec-10) X. Covered region (Mb) 3.7 (4.7..8.5) Lon Mec. Derived by insertion of myo-2p::GFP transgene into parental strain FX19171 using CRISPR/Cas9.
|
|
| CGC89 |
C. elegans |
tmIn58 [umnIs68] I; lig-4(tm750) III. Show Description
umnIs68 [myo-2p::GFP + NeoR, I:6284001(intergenic)] I. Break points: In(gsp-3 sre-23) I. Covered region (Mb) 3.5 (4.7..8.3). Derived by insertion of myo-2p::GFP transgene into parental strain FX19704 using CRISPR/Cas9.
|
|
| CH116 |
C. elegans |
hsb-1(cg116) IV. Show Description
Viable and fertile. Deletion of 664 bp, molecular null.
|
|
| CH1179 |
C. elegans |
unc-36(e251) emb-9(g23cg46)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and 3-fold lethals. cg46 is a 497 bp deletion that removes the last 22 nucleotides of intron 9 and 475 nucleotides of exon 10;
|
|
| CH1180 |
C. elegans |
unc-32(e189) emb-9(cg56)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and Uncs which arrest in the L1 stage.
|
|
| CH1315 |
C. elegans |
zmp-1(cg115) III. Show Description
Superficially wild-type. 2366 bp deletion (965-3330 of U41266(EGAP1)) caused by imprecise excision of Tc1. Deletion can be detected by PCR with primers DSP4 (AATTAGTTGACGAGACAAGTCAGG) and B3 (AGTGAAGGCAGAATGTACTCC) --306 kb WT vs 1.2 kb mutant.
|
|
| CHS1016 |
C. elegans |
gbb-2(yum1169) IV; gbb-1(yum1168) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1024 |
C. elegans |
pdfr-1(yum1024) III; seb-2(yum1025) V; seb-3(yum1026) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1053 |
C. elegans |
c29f9.8(yum1387) III; t26h8.4(yum1386) y75b12b.10(yum1388) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1105 |
C. elegans |
srab-6(yum1610) srab-7(yum1611) srab-8(yum1612) srab-9(yum1613) srab-10(yum1614) srab-11(yum1615) srab-20(yum1616) srab-21(yum1617) srab-22(yum1618) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1143 |
C. elegans |
srab-12(yum1836) V; srab-14(yum1837) II; srab-16(yum1838) srab-17(yum1839) srab-18(yum1840) srab-24(yum1841) srab-25(yum1842) srab-26(yum1843) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1145 |
C. elegans |
srab-1(yum1849) srab-2(yum1850) srab-3(yum1851) srab-4(yum1852) srab-13(yum1853) srab-23(yum1854) V; k08b5.1(yum1856) X; y41d4b.1(yum1855) IV. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1160 |
C. elegans |
e04d5.2(yum1950) c54d10.5(yum1951) t11f9.1(yum1952) y41d4b.24(yum1953) f32d8.10(yum1954) y37e11al.1(yum1955) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1204 |
C. elegans |
t03e6.9(yum2219) t03e6.8(yum2220) y37h2c.4(yum2221) c53d6.11(yum2222) w06g6.15(yum2223) y70c5b.2(yum2224) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1230 |
C. elegans |
srb-6(yum2387) srb-7(yum2388) srb-8(yum2389) srb-11(yum2390) srb-15(yum2391) srb-16(yum2392) srb-17(yum2393) srb-18(yum2394) srb-19(yum2395) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1266 |
C. elegans |
c31b8.1(yum2861) y70c5a.2(yum2862) w02h5.16(yum2863) w02h5.11(yum2864) f18e9.8(yum2865) m03f8.7(yum2866) y70c5a.4(yum2867) m01d7.9(yum2868) w06g6.15(yum2869) y70c5b.2(yum2870) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1269 |
C. elegans |
srb-1(yum2701) srb-2(yum2702) srb-3(yum2703) srb-5(yum2704) srb-12(yum2705) srb-13(yum2706) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1591 |
C. elegans |
f54e2.5(yum2833) c34b4.5(yum2834) f54e2.9(yum2835) f57b1.1(yum2836) f57b1.9(yum2837) f58f6.5(yum2838) f58f6.6(yum2839) t09e8.4(yum2840) y51a2b.2(yum2841) zc196.8(yum2842) zc196.9(yum2843) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CHS1713 |
C. elegans |
glb-33(yum2917) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
|
|
| CL183 |
C. elegans |
him-5(e1490) srf-4(ct109) V. Show Description
Animals commonly have a protruding vulva. Unc (slow moving and non-sinusoidal body posture). Egl. Ectopic surface binding of the lectins WGA and SBA. Males are infertile and Mab-crumpled spicules and abnormal rays and lack diagonal sex muscles.
|
|