K02E10.8 Homozygous. Outer Left Sequence: gcatcacatggaagccctat. Outer Right Sequence: tcccgaagatgaccacaaat. Inner Left Sequence: tccgcaagtttccagaaaag. Inner Right Sequence: atacgcgccacaaatcaact. Inner Primer PCR Length: 1249. Estimated Deletion Size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

kyIs235 [unc-86::snb-1::YFP + unc-4p::lin-10::RFP(intron) + odr-1::RFP]. Also known as unc-86::VAMP::YFP. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Homozygous viable. Deletion of 2190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGATTTTAAGAATACTTTCTTTTCCATAT ; Right flanking sequence: CACGGTTTCTTGAGAGATTTCTGGTTTTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Originally had kyEx648 [unc-86 + syg-1::GFP] in this strain, but the CGC stock does not contain the array.