Search Strains

Heterozygotes are Unc and express myo-2::GFP in the pharynx. unc-42(e270) spe-42(eb5) homozygotes are Unc and non-GFP. Whle unc-42(e270) spe-42(eb5) self progeny have not been quantified, spe-42(eb5) alone produces 9 self progeny at 16C and <1 self progeny at 25C. The Spe defect can be rescued by WT sperm. Homozygous nT1[unc-?(n754) let-? qIs50] are embryonic lethal.

Heterozygotes are DpyUnc and segregate DpyUnc and dead eggs.

Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Egg lethal. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Late larval lethal. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Mid-late larval lethal. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal late larval. Maintain by picking WT.

Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT.

Heterozygotes are WT.

Unc. At 25C ar39 recessively suppresses the Egl phenotype of n676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. ar39 recessively suppresses vulval lineage defects and proximal mitosis. Do not distribute this strain; other labs should request it from the CGC.

The double heterozygote is WT. WT will segregate WT, DpyUncs, mid-larval lethal (hT1 homozygotes) and dead eggs. The DpyUncs are homozygous for zu155 and zu148 and will segregate only dead embryos; the dead embryos have excess hypodermis and muscle and lack germ cells and intestine.

Pick wild-type to maintain. Segregates wild-type, Dpy Unc, arrested hT1 homozygotes, and dead eggs. Reference: McKim KS, et al. Genetics. 1988 Dec;120(4):987-1001.

Maintain by picking Lon non-Unc. Throws Lon non-Unc, Lon Unc Vab (bent head, tails very thin), and Lon Unc Mel (kinker, temperature-sterile).

Wild type hermaphrodites and males which produce WT, Dpy, Unc and DpyUnc progeny due to mating or loss of the duplication. Pick WT hermaphrodites and males to maintain.

otIs564 [unc-47(fosmid)::SL2::H2B::mChopti + pha-1(+)] V. Reporter tag inserted into fosmid WRM0626bG04. Him. Line 2-2. Inserted near unc-42. Brighter mCherry expression than in OH13104. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.

GFP tag inserted at the C-terminus of the endogenous unc-42 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Berghoff EG, et al. Elife. 2021 Jun 24;10:e64903. doi: 10.7554/eLife.64903. PMID: 34165428

CRISPR/Cas9 full deletion removing the entire coding-region of unc-42. Him and Unc. Reference: Fernandez RW, et al. Development. 2025 Aug 15;152(16):dev204958. doi: 10.1242/dev.204958. PMID: 40838983.

umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygotes Dpy and unhealthy. Deletion of 3929 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 Dpy adults (ve662 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: agaagaaacaaagaaatcccaaaaaaaaaa ; Right flanking sequence: Tatccgattattacagtattaaattctatc. sgRNA #1: aagaaaaaagaaacggtata; sgRNA #2: actgtaataatcggatATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous sterile. Deletion of 4483 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults(ve666 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: tagaatcaccccctggagctggagcatcct ; Right flanking sequence: cggggcgcacggaaattgcgtgcgcaacga. sgRNA #1: ctctttgtctctcactgtct; sgRNA #2: caagggatgttcactgcgcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygous sterile, Pvl. Deletion of 918 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile, Pvl adults (ve676 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: attaaatttttaaattattttcagcccgaa ; Right flanking sequence: GCAGCCAGAAAACTCGGCGGTTCATCAAAA. sgRNA #1: TCCACTCTTCCATtacgttc; sgRNA #2: TGGATTGTAGGAACGTGCTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Egl, Emb. Deletion of 479 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 Egl adults that have no viable eggs or hatch a few sickly progeny (ve901 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: CATTTATTGTGGTGGTGGGGCTCCACGGCC; Right flanking sequence: AGGTACTCATAGATGAGCTTGGTGTGGCTT. rps-10 sgRNA A: GAATCCGGCTCTGTAGACTG; rps-10 sgRNA B: CAGTCACTCCCTCGTTGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Sterile. Deletion of 459 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ heterozygotes, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 ve989 homozygotes (most are inviable, some reach adulthood and are sickly, sterile with a protruding vulva, some may produce a small brood), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: acttacAGCGGCCTTGAGCATGTCGCTGGT; Right flanking sequence: aggtcgaatgagaaaaaaattaattgatat. rps-17 crRNA A: ATCAGTGTCAACCTTGATGG; rps-17 crRNA B: gcgcaacgtaatagatgaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.