| RG3181 |
C. elegans |
+/mT1 [umnIs52] II; grwd-1(ve681[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
Y54H5A.1. umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 1630 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve681 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: GTCCGGTGAAAATGACGTTGAAATGCATGA ; Right flanking sequence: TATGGGTCAGAATGAGGTCAAAGAAGTTCA. sgRNA #1: TGACGTTGAAATGCATGATG; sgRNA #2: ACAGCTGATGTTCGTCCATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3190 |
C. elegans |
+/mT1 [umnIs52] II; Y54H5A.2(ve690[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous sterile. Deletion of 12039 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve690 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: cacttgcagtttccgcttgatcacccaaat ; Right flanking sequence: cccgggtacgcgtccttctcaccgacaaac. sgRNA #1: ccgcttgatcacccaaatta; sgRNA #2: gtatacctcattcgcccacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3198 |
C. elegans |
+/mT1 [umnIs52] II; ZK686.3(ve698[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 1309 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve698 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tctttggagaaggggaaaacaccttctagt ; Right flanking sequence: GACGGCGAGCAGCATgaagaacagtaatac. sgRNA #1: gggaaaacaccttctagttt; sgRNA #2: CTGCTGAGCCGACTCGTAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3223 |
C. elegans |
sec-11(ve723[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygotes are sick, Egl. Deletion of 2571 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sick, Egl adults (ve723 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: AGTTTTCCTTATGCAACAGGACGAAGAGAC ; Right flanking sequence: GAAGGAACTTCATctgaaatgggattatgc. sgRNA #1: GCAACAGGACGAAGAGACCG; sgRNA #2: TGAACATCGCAACATCGGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3224 |
C. elegans |
+/mT1 [umnIs52] II; sftb-1(ve724[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval lethal. Deletion of 5479 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve724 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: gggattaaaatataaaaggtttcgttttct ; Right flanking sequence: atattcaaagaaatacactcaagaaactaa. sgRNA #1: atgaaaatgtgatgaaagga; sgRNA #2: tgttcattgtaaaaggatta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3226 |
C. elegans |
+/mT1 [umnIs52] II; snr-5(ve726[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Emb. Deletion of 430 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead embryos (ve726 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ttgcttaaattacttgtgtccttca ; Right flanking sequence: GGGAGGCGTGGACGGAGAAAACGAG. sgRNA #1: agggatatcgaaaatagtga; sgRNA #2: TGCAACAACGTTCTCTACGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3245 |
C. elegans |
+/mT1 [umnIs52] II; Y48A6C.4(ve745[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 6712 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve745 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tgggaataattttctctcgaatcaatatct ; Right flanking sequence: tttaattttttaaagttaaaaattttctag. sgRNA #1: atgaaacttgcacttcaccg; sgRNA #2: aagcggagtcgggaagaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3259 |
C. elegans |
+/mT1 [umnIs52] II; cisd-3.1(ve759[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous late larval arrest. Deletion of 375 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve759 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ctcagttatgtgtgaatgttatcagtttta ; Right flanking sequence: TGGATATAGTGGATCGCAACCACTCTGCGA. sgRNA #1: cagaATGCGGATAACTCAAT; sgRNA #2: GTTTACGCATGGTGCAGTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3267 |
C. elegans |
+/mT1 [umnIs52] II; C16C10.8(ve767[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous late larval lethal or sterile. Deletion of 1175 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 larvae (ve767 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: atggtgtttcatgagaaatgtggctctccc ; Right flanking sequence: TTGACAATCAATACAGCTGAAAGTAGTATT. sgRNA #1: tgaactcacacaatttcacc; sgRNA #2: CTTGTCTACACgtaagcttc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3268 |
C. elegans |
+/mT1 [umnIs52] II; F10E9.11(ve768[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous early larval arrest. Deletion of 665 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve768 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tTCATTTCTTCTCCTTTTTCTCCTTATCCA ; Right flanking sequence: aaaatataatttatgccagtaatgagtatc. sgRNA #1: CGAGAGGATACAGAAAAGAG; sgRNA #2: cgaaattcatgtcacgagcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3277 |
C. elegans |
+/mT1 [umnIs52] II; C14B1.8(ve777[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Mes. Deletion of 858 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 viable adults that produce progeny most of which are sterile (ve777 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TTTTCTTGAGCTTCATCGTCATCGAATCCG ; Right flanking sequence: TGGATTATCCATttttgaactgaaaattca. sgRNA #1: AAAATTATCAGCGAGGGAGA; sgRNA #2: AATAAGTCGATTTCTTTAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3283 |
C. elegans |
+/mT1 [umnIs52] II; pod-1(ve783[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous maternal effect lethal. Deletion of 9240 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 adults that lay dead eggs (ve783 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: gagacaaataaaaagcgagagagggagagg ; Right flanking sequence: tggcccgaaatttatatcaattttgcggac. sgRNA #1: tggtgatggattggtgatgg; sgRNA #2: agcgcacacacaaacacaag. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3289 |
C. elegans |
+/mT1 [umnIs52] II; trmt-10C.2(ve789[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. C56G2.3. Homozygotes arrest as late larvae or become sterile adults. Deletion of 1669 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve789 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: acttctggactttaattcccttacctatta ; Right flanking sequence: aggtgaagctgagcgtggcaactcacttca. sgRNA #1: cccagtgacgatattgagat; sgRNA #2: tttctctagctctttcagac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3318 |
C. elegans |
+/mT1 [umnIs52] II; prx-10&wrs-2(ve818[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous late larval arrest/sterile. Deletion of 3348 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae/sterile adults (ve818 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TCAGCGAAGAGATGAAGAGTATATTGAAGA ; Right flanking sequence: ACTGAAAATGGTGAAAAGGCTCGAGAAATT. sgRNA #1: TATTACAGAAAGATTGAGCA; sgRNA #2: TAGCACTTTGTCAACCTGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3319 |
C. elegans |
+/mT1 [umnIs52] II; wrs-2(ve819[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous Ste, Pvl. Deletion of 1420 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve819 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AGTTGATCAACACGCTATTTCACTTGGACC ; Right flanking sequence: ACTGAAAATGGTGAAAAGGCTCGAGAAATT. sgRNA #1: ACTTCCAGCAAATGAGGTTG; sgRNA #2: TAGCACTTTGTCAACCTGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3400 |
C. elegans |
+/mT1 [umnIs52] II; rps-13(ve900[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 776 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 ve900 homozygotes (larval arrest), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TCCAGGTTGGTGGAAGCTGACGCTTGGTCT; Right flanking sequence: ACCCATGGTTGATGCGGATTACCTGAAAGA. rps-13_C16A3.11 sgRNA A: TGTAGTATCTAGCCAAACGG; rps-13_C16A3.11 sgRNA B: CGCATGCACAATCCAGGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3401 |
C. elegans |
rps-10(ve901[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Egl, Emb. Deletion of 479 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 Egl adults that have no viable eggs or hatch a few sickly progeny (ve901 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: CATTTATTGTGGTGGTGGGGCTCCACGGCC; Right flanking sequence: AGGTACTCATAGATGAGCTTGGTGTGGCTT. rps-10 sgRNA A: GAATCCGGCTCTGTAGACTG; rps-10 sgRNA B: CAGTCACTCCCTCGTTGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3447 |
C. elegans |
+/mT1 [umnIs52] II; mdh-2(ve947[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 1490 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae, (ve947 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tctgttcatcatgtttcacgtggatgagag; Right flanking sequence: CGGCAACTCCTGGAGTATTGACGACGTCGT. mdh-2 sgRNA A: ggaagagacacagacagcgc; mdh-2 sgRNA B: ATCAATGTGCGAAAGATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3452 |
C. elegans |
+/mT1 [umnIs52] II; mlc-3(ve952[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Arrested larvae. Deletion of 1712 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested early larvae (ve952 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Note: This strain exhibits pleiotropic expression of GFP in body wall. Left flanking Sequence: tttccacactcagtcccccctgctctgccg; Right flanking sequence: CTCAAGGGAGTCGAAGACGGAGAAGGCATG. mlc-3 crRNA A: atgtgtgagtgttgcagcgg; mlc-3 crRNA B: GAGCTCATCGGCCTCATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3462 |
C. elegans |
ndub-8(ve962[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 2603 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve962 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: CAATAAAATTCGATTGCTGATAGCGTCACA; Right flanking sequence: CTCTCCTCGCCTGGTACTTTACCAACGAAC. ndub-8 sgRNA A: AGACCGGTTCACGTGATAGG; ndub-8 sgRNA B: CCATCGGTACGAGCACGCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3482 |
C. elegans |
+/mT1 [umnIs52] II; copd-1(ve982[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Embryonic lethal. Deletion of 1942 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, dead embryos (ve982 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AATGTGTACTCAATATTGACTTGGACTCCA; Right flanking sequence: CATGAGCAGGAAAAACTTTTTTGGCAGGCA. copd-1 crRNA A: TGGCCTCAAGAATCATCTGA; copd-1 crRNA B: GCCTAAAACTACCCTTTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3484 |
C. elegans |
+/mT1 [umnIs52] II; eftu-2(ve984[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 2360 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve984 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Note: some, but not all balanced heterozygotes display vulva phenotypes such as blips, explode at vulva, and/or egl. Left flanking Sequence: TGTTCTTCATGAAGATAAAAAGTACTATGC; Right flanking sequence: TGGAGGTCAGATGATCCCAACTGCACGCCG. eftu-2 sgRNA #1: TACAGCTCTCGAAGTATACG; eftu-2 sgRNA #2: ACAGAACCACTTTATCGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3485 |
C. elegans |
+/mT1 [umnIs52] II; rpl-21(ve985[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 489 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve985 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: CACGGTTCAAGAAGTCGGTTCTGCACTTGG; Right flanking sequence: aggaacaaaaatgtaaaacaatttgccgag. rpl-21 crRNA A: ATGGCTTGATGTGCTCGATA; rpl-21 crRNA B: tgtcaatatagagaactacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3489 |
C. elegans |
rps-17(ve989[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Sterile. Deletion of 459 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ heterozygotes, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 ve989 homozygotes (most are inviable, some reach adulthood and are sickly, sterile with a protruding vulva, some may produce a small brood), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: acttacAGCGGCCTTGAGCATGTCGCTGGT; Right flanking sequence: aggtcgaatgagaaaaaaattaattgatat. rps-17 crRNA A: ATCAGTGTCAACCTTGATGG; rps-17 crRNA B: gcgcaacgtaatagatgaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3494 |
C. elegans |
+/mT1 [umnIs52] II; pars-1(ve994[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval lethal. Deletion of 1632 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve994 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AGAGATCGAGGAGCAAGGAGCCGAAGTCCG; Right flanking sequence: TCAAATCTCTTCTTGATGAAATTCATACTG. pars-1 crRNA A: TCTTGTCACCTTTCACACGG; pars-1 crRNA B: CAGTTTTAGACAGTCCTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3501 |
C. elegans |
F58G1.2(ve1001[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Sterile. Deletion of 3478 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve1001 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TATTGTAAACATTAAAATGTGGGAAAACTG; Right flanking sequence: TCCTGATTGTTCCTGTAATTAATTGCATTA. F58G1.2 crRNA A: GGTGAAATCGTCATTGAACG; F58G1.2 crRNA B: CAAGCAACGAGAAACAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3518 |
C. elegans |
+/mT1 [umnIs52] II; D2045.9(ve1018[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Emb. Deletion of 3962 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead embryos (ve1018 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ATAGACTACTATTTGAAGGCTAACTTTCCA; Right flanking sequence: AGGAATTGTGattttatttaaattttgttt. D2045.9 crRNA A: ATTTCCCGGTCAACGCAACG; D2045.9 crRNA B: GACACCGAAACCTAAAAGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3540 |
C. elegans |
+/mT1 [umnIs52] II; rps-14(ve1040[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 921 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve1040 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: agctgagccttcgatctgaacaaactccca; Right flanking sequence: tggaaaaagtcgctacgcagccaatggtct. rps-14 crRNA A: atagttaagtatgctctggc; rps-14 crRNA B: ttggctgcgtatcatttcca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3541 |
C. elegans |
+/mT1 [umnIs52] II; spe-21(ve1041[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Semi sterile. Deletion of 1602 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 ve1041 homozygotes (mostly sterile; see below), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Most ve1051 homozygotes lay only oocytes, but a few escaper ve1041 GFP+ hemaphrodites can lay small broods of similarly semi-sterile progeny. Left flanking Sequence: GCGAGATTTGGTAACTGAAAAAGGTAACCA; Right flanking sequence: ATTCGGCAAAATCAGATAATAAGAAATTCG. dhhc-5 crRNA A: TGGGTGCATGGACTATTGCA; dhhc-5 crRNA B: GTGGTTGGAACGCACAAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5002 |
C. elegans |
+/mT1 [umnIs52] II; psd-1(gk5580[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5580 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4509 and CGC66. gk5580 is a 6731 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TACAAGCTCGACACTTGCCACGTGGACTAA. Right flanking sequence: TCTGGCGGACCGAAGAACGTTGAAAAGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5031 |
C. elegans |
+/mT1 [umnIs52] II; tftc-5(gk5467[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5467 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4389 and CGC66. gk5467 is a 2935 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTCGTATTATGGCGGAACGGAAACCTCAG; Right flanking sequence: GCAATGAATGAGCTAGTGGCTGTTGTAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5032 |
C. elegans |
+/mT1 [umnIs52] II; C14B9.10(gk5476[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5476 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4398 and CGC66. gk5476 is a 1853 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACCAAACCGTCAGACATGCTGCGTCTCCT; Right flanking sequence: AACTGGCAAGAAATGGTTCCGCATTGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5033 |
C. elegans |
+/mT1 [umnIs52] II; F45G2.10(gk5482[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5482 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4404 and CGC66. gk5482 is a 2468 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTAAACACGTTTTTATTCGAAACCTGAT. Right flanking sequence: GCTGGAAATGGAAAATGACGAAAAAATATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5034 |
C. elegans |
+/mT1 [umnIs52] II; mrps-18C(gk5520[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5520 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4445 and CGC66. gk5520 is a 1322 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAGGTCGCAGAAGAACATTGACCCCAGCTC; Right flanking sequence: GAAGAGATAAAACGAAAGCTAAGATTGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5035 |
C. elegans |
+/mT1 [umnIs52] II; C16C10.2(gk5524[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5524 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4449 and CGC66. gk5524 is a 957 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAACTACTTCTTTCGTTCATAGGTCCATTT. Right flanking sequence: CGAGGACATGGCTGGCTGAAAATAATTTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5036 |
C. elegans |
+/mT1 [umnIs52] II; gop-2(gk5528[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5528 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4453 and CGC66. gk5528 is a 1052 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence:CTATTTTCAGCGTCTCACAGCATTCCTACA ; Right flanking sequence: GAATTTCTGGAGTCGGAGTTGAATTCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5037 |
C. elegans |
+/mT1 [umnIs52] II; C16A3.6(gk5536[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5536 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VCVC4462 and CGC66. gk5536 is a 1237 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAAGATGAAAATAGAGAGAAGGCGCCT; Right flanking sequence: CAAAGGGTCAAGGCATAAAACTTCGCATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5038 |
C. elegans |
+/mT1 [umnIs52] II; Y37D8A.16(gk5539[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5539 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4466 and CGC66. gk5539 is a 2739 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAAACGCAATTATAAGATCCCTTCGAGATA; Right flanking sequence: GTATACAGTTCCGGTGCATGACTAATGTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5039 |
C. elegans |
lat-1(gk5420[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5420 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4337 and CGC66. gk5420 is a 11293 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CTCTCCTCTATGCTTTCTCTAGTTTTGCCT; Right flanking sequence: GACGGTGCTTCGAATTGATTTGAACAAGCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5041 |
C. elegans |
+/mT1 [umnIs52] II; unc-116(gk5722[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5722 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4653 and CGC66. gk5722 is a 2264 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCTTTGAAATGACGGATTTTTGGACCACAT; Right flanking sequence: CCCGGCTTCTCCTTACAATGCCTGCAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5042 |
C. elegans |
+/mT1 [umnIs52] II; lars-1(gk5763[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5763 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4694 and CGC66. gk5763 is a 5294 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GACGTTAGCCTTGTACACAATAGTACGCCC; Right flanking sequence: TGGCCTAGTTTTGCAATGGCATCGACCGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5043 |
C. elegans |
kars-1(gk5813[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5813 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4745 and CGC66. gk5813 is a 2292 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGAGAGAAAAGCAATAGAGGGGTCTCGCCG; Right flanking sequence: CGGAATTATGGACAAAAAGCGAAAAATCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5048 |
C. elegans |
+/mT1 [umnIs52] II; tost-1(gk5543[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5543 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4470 and CGC66. gk5543 is a 1358 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGTTTTATGCACCTCCGTATCACACCACCA; Right flanking sequence: TGTTGCTGTGCTCACGGTCAGCTAAAGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5050 |
C. elegans |
+/mT1 [umnIs52] II; C35D10.5(gk5552[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5552 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4480 and CGC66. gk5552 is a 1321 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAGAAAACCGAAAAATGTTCTCGTTGCTCC; Right flanking sequence: ATTGTTTATACGCGTGTTTCTCTCCACTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5053 |
C. elegans |
+/mT1 [umnIs52] II; C36A4.4(gk5562[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5562 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4490 and CGC66. gk5562 is a 1777 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGAAGACGTCGAAAATAAACTGCTCCAGCT; Right flanking sequence: GGTGGAAAACAATTCAAAAAGTGATAATAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5054 |
C. elegans |
+/mT1 [umnIs52] II; : nlp-48(gk5563[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5563 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4491 and CGC66. gk5563 is a 1026 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCAAATGGTAAGTTCTTACATAGGCCCCAG; Right flanking sequence: CGTGGATTTTAATATTAAAGTATCGTCCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5056 |
C. elegans |
+/mT1 [umnIs52] II; idhg-1(gk5648[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/ mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (gk5648 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VC4577 and CGC66. gk5648 is a 2420 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAACACGTGCGGCGCTTGCAAATCAATCG; Right flanking sequence: TTACGTTCTTTTCCTCTGTTTTTTTTTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5059 |
C. elegans |
'+/mT1 [umnIs52] II; famh-136(hd7024[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick wild-type GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal deletion balanced over mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7024 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7027 and CGC66. hd7024 is a 542 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTGAGCTTTAGCTATCTTCCTTTATCCT; Right flanking sequence: ATCACAGGTGTGAAGATTTATTAAATTTTA. sgRNA #1: ATGAATGACGCAAGAATTAA; sgRNA #2: TCTGAATACTTATTGACATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5105 |
C. elegans |
+/mT1 [umnIs52] II; mrpl-44(gk5627[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, GFP+ non-mKate2 gk5627 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4556 and CGC66. gk5627 is a deletion of 2142 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GATGGGAGGACAAAGAGCAAAGCGGAGATG. Right flanking sequence: ATATTTCCGGTGCTCCAATTCTGTGTCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG5106 |
C. elegans |
+/mT1 [umnIs52] II; eif-3.D(gk5753[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Apparent homozygous lethal or sterile deletion balanced over labeled mT1. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+ heterozygotes, GFP+ non-mKate2 gk5753 homozygotes, sterile Dpy mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. [NOTE: there is also red fluorescence apparent in the hypodermis or body wall.] Maintain by picking wild-type GFP+ & mKate2+ and check for correct segregation of progeny to maintain. Derived from parental strains VC4684 and CGC66. gk5753 is a deletion of 2118 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCGAATACAAGAAATTGTCAGAAACCGGGG. Right flanking sequence: GACGCCACCTCAATTTTTGGTTTTTATTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|