| MCJ583 |
C. elegans |
alg-1(cdb153[D740A]) X. Show Description
cdb153 is an engineered D740A substitution in the short isoform of alg-1, mutating the DDH catalytic triad to ADH. Catalytically inactive allele of alg-1. sgRNA #1: GACATCACTCATCCACCAGC; sgRNA #2: GCTACCATAGGCACCACGAG. sgRNA #2 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816.
|
|
| MCJ639 |
C. elegans |
alg-2(cdb12 cdb51[3xFLAG::alg-2] cdb370[D627A]) II. Show Description
3xFLAG tag inserted at N-terminus of short isoform of endogenous alg-2 locus. cdb370 is an engineered D627A substitution in the short isoform of alg-2, mutating the DDH catalytic triad to ADH. Catalytically inactive allele of alg-2. sgRNA #1: GATGGGTGATGTCGCAACCC. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816.
|
|
| MIR260 |
C. elegans |
risIs31. Show Description
risIs31 [hsp-16.2p::grh-1b::GFP + unc-119(+)]. Long lived without heat shock. Heat shock induces over-expression of grh-1 causing short-lived phenotype and nuclear GFP expression. Described as "hsp-16.2p::grh-1::gfp OEx line 1" in referenced paper. Reference: Grigolon G, et al. Nat Commun. 2022 Jan 10;13(1):107. doi: 10.1038/s41467-021-27732-4. PMID: 35013237.
|
|
| MIR262 |
C. elegans |
risls32. Show Description
risls32 [grh-1p::grh-1b::GFP + unc-119(+)]. Over-expression of grh-1 from its endogenous promoter. Short lived, no GFP signal visible. Reference: Grigolon G, et al. Nat Commun. 2022 Jan 10;13(1):107. doi: 10.1038/s41467-021-27732-4. PMID: 35013237.
|
|
| MQ1343 |
C. elegans |
dsc-1(qm133) X. Show Description
Pale. Short defecation cycle length. Expulsion defective.
|
|
| MQ1444 |
C. elegans |
dsc-1(tm241) X. Show Description
Pale. Short defecation cycle length. Expulsion defective.
|
|
| MQ200 |
C. elegans |
mud-1(qm21) III. Show Description
Maternal effect Uncoordinated and Dumpy. High degree of embryonic and larval lethality. Dpy phenotype only partially resuced. Hatchlings are of variable length, with poor movement. Adults are short and show kinky uncoordination.
|
|
| MQ228 |
C. elegans |
mad-2(qm62) I. Show Description
Maternal effect dumpy. Adults are short but larvae are not. Animals are lethargic but display hyperactive foraging movement and very rapid pumping when stimulated by light touch. Hermaphrodite and male tails are abnormal. Very slow development. High degree of embryonic and larval lethality.
|
|
| MQ4 |
C. elegans |
mau-2(qm4) I. Show Description
Maternal effect uncoordinated. Egg-laying defective. Some larval lethality. Full zygotic rescue. Almost complete maternal rescue, no maternal rescue of egg-laying defect. Neuroanatomical defects. Short excretory canals.
|
|
| MQ468 |
C. elegans |
hmp-2(qm39) I. Show Description
Maternally rescued Dpy. Fully zygotically rescued but only partially maternally rescued. Some embryonic lethality and a high degree of larval lethality. Very poor embryonic elongation. Hatchlings are short and deformed. In later stages the anterior half of the body is short but well developed while the posterior is thin.
|
|
| MSB1041 |
C. elegans |
bus-17(br2) X; mirIs92. Show Description
mirIs92 [daf-16p::daf-16::GcNL::let-858 3'UTR + myo-2p::mCherry]. bus-17(br2) has defective response to short wavelength light; response strongly reduced but not eliminated. Altered surface properties; somewhat skiddy movement; drug-sensitive, bleach-sensitive. Resistant to some bacterial pathogens (hence Bus, Bah phenotypes) and hypersensitive to others. daf-16 translational reporter with green non-calcium sensitive nanolantern (GCNL). Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: 36463346.
|
|
| MSB577 |
C. elegans |
bus-17(br2) X; mirEx123. Show Description
mirEx123 [myo-3p::TeNL::unc-54 3' UTR]. Maintain strain by picking animals with blue fluorescence. bus-17(br2) has mutant defective response to short wavelength light; response strongly reduced but not eliminated. Altered surface properties; somewhat skiddy movement; drug-sensitive, bleach-sensitive. Resistant to some bacterial pathogens (hence Bus, Bah phenotypes) and hypersensitive to others. Calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in muscles. Reference: Morales-Curiel LF, et al. Commun Biol. 2022 Dec 3;5(1):1330. doi: 10.1038/s42003-022-04292-x. PMID: 36463346.
|
|
| NF4629 |
C. elegans |
vha-7(tk181) IV. Show Description
Short lifespan. vha-7(tk181) is a point mutation isolated as a suppressor of sqv-5(k175). tk181 represses the formation of tubular lysosome. Reference: Shibata Y, et al. Scientific Reports. In press.
|
|
| NJ268 |
C. elegans |
pat-3(rh96) III. Show Description
Short excretory canal, incomplete QR, HSN migrations, post DTC loops.
|
|
| NJ340 |
C. elegans |
exc-2(rh105) X. Show Description
Short swollen, bubbly excretory canal (resembles rh90).
|
|
| NJ683 |
C. elegans |
exc-7(rh252) II. Show Description
Excretory canal defect. Canal is invariably short with multiple cysts of varying size clustered along length, especially at the tips. Visible only by Nomarski microscopy. Tail spike is often slightly malformed. Animal is somewhat pale.
|
|
| NKZ35 |
C. inopinata |
Caenorhabditis inopinata wild isolate Show Description
Caenorhabditis inopinata wild isolate; 10x inbred line. Male-Female. Maintain by mating at 25C or above; does not grow well at 20C. See reference for the details d(https://www.nature.com/articles/s41467-018-05712-5). Sibling species of C. elegans. Inbred 10 times, full genome sequence available. Frozen stock recovery is lower efficiency than C. elegans with glycerol; DMSO method works more efficiently.
Adult: Large and slender species; ca. 1.5–2.5 mm in length, and individuals may reach up 3.0 mm under optimal culturing conditions. Cuticle is moderate to thick with four-lined lateral field. Deirids on the lateral field, at the level slightly behind the secretory–excretory pore. Lip separated into six sectors, not clearly offset. Six labial sensilla and four cephalic sensilla present. The anterior end of each lip sector very slightly elongated and forming six stomatal flaps. Amphid small, oval pore-like, at the level of the margin of cheilo and gymnostom. Tube-like stoma separated into three parts; short tube-like cheilostom; simple tube-like gymnostom, which is weakly separated into two subsections; and tube-like stegostom covered by pharyngeal sleeve, which is separated into four subsections, prostegostom, mesostegostom, metastegostom, and telostegostom. Metastegostomatal three teeth flap-like. Pharynx separated into four sections; procorpus forming muscular tube, well-developed metacorpus (median bulb); glandular and narrow isthmus; and basal bulb with double haustrulum as the glottoid apparatus. Pharyngo-intestinal valve (cardia) prominent. Nerve ring around the middle of isthmus. Excretory pore located around the margin of isthmus and basal bulb.
Female: Gonadal system didelphic, amphidelphic. Anterior and posterior gonadal system are basically symmetric with each other, arranged as ovary, oviduct, spermatheca, spermathecal-uterus junction tissue, uterus and vulva/vagina from distal. Sometimes more than 20 developing eggs are deposited. Tail conical or forming slightly elongated conus with pointed tip. Anus and rectum clearly visible; three (two subventral and one dorsal) rectal glands present. Phasmid forming small pore at ca. 60% of total tail length from anus.
Male: Testis single, anteriorly reflexed rightwardly. Vas deferens occupying ca. 1/5 of total gonadal length. Tail enveloped by a closed bursa, supported by nine pairs of bursal rays. Anterior cloacal lip with a rounded and sclerotized appendage and bulge-like appendage between rounded appendage and cloacal opening; a small sensilla-like papilla on the bulge-like appendage. Posterior cloacal lip with tongue-like appendage with two cloacal sensilla. Spicules paired, separate, long and slender with evenly slightly ventrally curved blade and simply pointed tip. Gubernaculum slender, ventrally arcuate with small squared appendage at the distal end in lateral view. Bursa heart-shaped in ventral view, anteriorly closed with serrated edge; serratae obvious in anterior half and vague in posterior half; terminal notch present but unclear. The nine pairs of genital papillae or bursal rays supporting the bursal velum with an arranged (2/1 + 1 + 2 + 3).
|
|
| NU3 |
C. elegans |
dbl-1(nk3) V. Show Description
Previously called cet-1(kk3). Short, somewhat Dpy. Males have crumpled spicules and abnormal rays; Similar to sma-2, sma-3, sma-4, sma-6 and daf-4.
|
|
| OH13099 |
C. elegans |
otIs583. Show Description
otIs583 [gcy-5p*::GFP + ttx-3p::mCherry]. Robust GFP expression in both ASE neurons. mCherry expression in AIY meurons. *This strain contains a short gcy-5 promoter with the CHE-1 binding ASE motif multimerized. GFP expression is strong enough to visualize morphology of both ASE neurons simultaneously. Reference: Patel T & Hobert O. eLife 2017. Etchberger JF, et al. Development. 2009 Jan;136(1):147-60.
|
|
| OH15205 |
C. elegans |
otEx7057. Show Description
Pick TagRFP+ animals to maintain. otEx7057 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B]. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Injected into N2. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH15262 |
C. elegans |
otIs669 V. Show Description
otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH15263 |
C. elegans |
otIs670 V. Show Description
otIs670 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH15363 |
C. elegans |
otIs669 him-5(e1490) V Show Description
High incidence of males (Him). otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Not known where otIs669 maps relative to him-5. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH15430 |
C. elegans |
pha-1(e2123) III; otIs669 V. Show Description
Maintain at 15C. Temperature-sensitive. Slow growing. otIs669 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH15495 |
C. elegans |
otIs696. Show Description
otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B]. Insertion site unknown, but not on LG V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH15528 |
C. elegans |
him-5(e1490) V; otIs696. Show Description
High incidence of males (Him). otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH15845 |
C. elegans |
daf-16(ot853[daf-16::mNG::AID*]) I; daf-2(e1370) III; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
|
|
| OH15913 |
C. elegans |
daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP::AID*]) X; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-12 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
|
|
| OH16289 |
C. elegans |
otIs696; wtfIs5. Show Description
wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. otIs696 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH16298 |
C. elegans |
him-8(e1489) IV; otIs670 V. Show Description
Him. [NOTE: strain does not segregate many male progeny.] otIs670 provides a healthier alternative to otIs669, performing better in a variety of phenotypic assays. otIs670 [UPN::NLS::TagRFP-T + acr-5::NLS::mTagBFP2::H2B + flp-1::NLS::mTagBFP2::H2B + flp-6::NLS::mTagBFP2::H2B + flp-18::NLS::mTagBFP2::H2B + flp-19::NLS::mTagBFP2::H2B + flp-26::NLS::mTagBFP2::H2B + gcy-18::NLS::mTagBFP2::H2B + ggr-3::NLS::mTagBFP2::H2B + lim-4::NLS::mTagBFP2::H2B + pdfr-1::NLS::mTagBFP2::H2B + srab-20::NLS::mTagBFP2::H2B + unc-25::NLS::mTagBFP2::H2B + cho-1::NLS::CyOFP1::H2B + flp-13::NLS::CyOFP1::H2B + flp-20::NLS::CyOFP1::H2B + gcy-36::NLS::CyOFP1::H2B + gpa-1::NLS::CyOFP1::H2B + nlp-12::NLS::CyOFP1::H2B + nmr-1::NLS::CyOFP1::H2B + ocr-1::NLS::CyOFP1::H2B + osm-9::NLS::CyOFP1::H2B + srh-79::NLS::CyOFP1::H2B + sri-1::NLS::CyOFP1::H2B + srsx-3::NLS::CyOFP1::H2B + unc-8::NLS::CyOFP1::H2B + acr-2::NLS::mNeptune2.5 + ceh-2::NLS::mNeptune2.5 + dat-1::NLS::mNeptune2.5 + dhc-3::NLS::mNeptune2.5 + eat-4::NLS::mNeptune2.5 + flp-3::NLS::mNeptune2.5 + gcy-35::NLS::mNeptune2.5 + glr-1::NLS::mNeptune2.5 + gcy-21::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + klp-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + lim-6::NLS::mNeptune2.5::T2A::NLS::CyOFP1::H2B + mbr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + mec-3::NLS::CyOFP1::H2B::T2A::NLS::mTagBFP2::H2B + odr-1::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B + srab-20::NLS::mNeptune2.5::T2A::NLS::mTagBFP2::H2B] V. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene used to resolve unique neural identities in whole-brain images. Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
|
|
| OH16508 |
C. elegans |
daf-16(ot975[daf-16::mNeptune2.5::3xFlag::AID*]) I; daf-2(e1370) III; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
|
|
| OH7204 |
C. elegans |
sax-7(ky146) IV; oyIs14 V; otEx3135. Show Description
oyIs14 [sra-6::GFP + lin-15(+)]. otEx3135 [myo-3p::sax-7cDNA short + rol-6(su1006)]. Pick Rollers to maintain. Reference: Pocock R, et al., Mol Cell Neurosci. 2008 Jan;37(1):56-68.
|
|
| PB101 |
C. briggsae |
Cbr-cby-3(bd101) X. Show Description
Chubby (short and fat--analogous to C. elegans Dpy phenotype). Parental strain is Caenorhabditis briggsae G16. Males are chubby, therefore cby-3 is X-linked.
|
|
| PFR510 |
C. elegans |
set-2(bn129)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
Maintain at 20C or cooler. qIs26 [lag-2::GFP + rol-6(su1006)]. set-2 mutation balanced by glp-1- and dpy-19-marked recombination suppressor. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Heterozygotes are Rollers and GFP+ in the distal tip cell, and segregate WT Rol, lethal qC1 homozygotes, and set-2(bn129) homozygotes (Mrt phenotype at 25C -- viable but homozygotes will become sterile in successive generations). Pick WT GFP+ Rol and check for correct segregation of progeny to maintain. set-2(bn129) homozygotes are short-lived on OP50. bn129 is a deletion removing 748 bp from exon 11 of SET-2L and from exon 3 of SET-2S resulting in a frameshift after 885 aa of SET-2L and after 117 aa of SET-2S with a premature stop four codons later. References: Robert VJ, et al. Front Cell Dev Biol. Dec 2020 Sep 22:8:561791.
doi: 10.3389/fcell.2020.561791. PMID: 33072747. Xiao Y, et al. Proc Natl Acad Sci USA. 2011 May 17;108(20):8305-10. doi: 10.1073/pnas.1019290108. PMID: 21527717.
|
|
| PJ1305 |
C. elegans |
unc-43(n498j038) IV; ccIs55; njEx38. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. njEx38 [unc-54p::daf-2(+) + goa-1p::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. unc-43 gain-of-function suppressed; not markedly small. Egl-d. Lethal @ 25C; short L1's do not survive. No GFP expression.
|
|
| PQ535 |
C. elegans |
alg-1(ap428 [alg-1::Y45F10D.4 3'UTR]) X. Show Description
alg-1(ap428 [alg-1::Y45F10D.4 3’UTR]) X. alg-1 control strain. ap428 is a CRISPR-engineered allele in which the endogenous alg-1 3'UTR was replaced by the Y45F10D.4 3'UTR. The Y45F10D.4 3'UTR was chosen because it appears to be stably expressed, is commonly used as a control gene in quantitative RT-PCR experiments, and its short 3’UTR lacks ALG-1 binding sites. Reference: Aalto AP, et al. PLoS Genet. 2018 Jun 21;14(6):e1007379.
|
|
| QK67 |
C. elegans |
alg-1(xk5[3xFLAG::alg-1]) X. Show Description
3xFLAG tag inserted at N-terminus of short isoform of endogenous alg-1 locus. sgRNA #1: TATTGCGGCCCGCCGGACAT; sgRNA #2: TCAAACGACCCAATGTCCGG. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816.
|
|
| SN5 |
C. elegans |
old-1(mk1) II. Show Description
Stress sensitive (UV light and heat). Slightly short-lived. Morphology is normal.
|
|
| SP1196 |
C. elegans |
dyf-7(m539) X. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective. Animals slightly short.
|
|
| SP1713 |
C. elegans |
dyf-11(mn392) X. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective. Animals slightly short.
|
|
| SP1745 |
C. elegans |
dyf-5(mn400) I. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective. Animals slightly short.
|
|
| SV1438 |
C. elegans |
unc-119(ed3) III; heSi141 X. Show Description
heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Strain is viable at 15-25 C, but non-tissue specific recombination is observed more frequently in other tissues at higher temperatures (25C). Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
|
|
| SV1440 |
C. elegans |
unc-119(ed3) III; heIs105 IV; heSi141 X. Show Description
heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Maintain at 15-25C. Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. heIs105 carries a read-out construct which allows the visualization of the CRE lox mediated recombination in the mesoblast lineage by a switch from red to green. This read-out construct is silenced in the germline. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
|
|
| SV1448 |
C. elegans |
fzr-1(ku298) II; unc-119(ed3) III; heSi143 IV; heSi141 X. Show Description
heSi 143 [rps-27::loxP::mCherry::let-858::fzr-1p::fzr-1::fzr-1 UTR::loxP::GFP::let-858 UTR + unc-119(+)] IV. heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Maintain at 15-25C. Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. heSi143 rescues fzr-1(ku298). fzr-1 will be excised upon mesoblast-specific expression of CRE, creating a mesoblast specific mutant of fzr-1. This recombination event can be visualized by a switch from red to green in those cells (the mesoblast) were fzr-1 is lost. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
|
|
| SV1578 |
C. elegans |
unc-119(ed3) III; heIs105 IV; swsn-1(os22) heSi164 V; heSi141 X. Show Description
heIs105 [rps-27::loxP::NLS::mCherry::let858 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. heSi164 [rps-27::loxN::NLS::mCherry::let858 UTR::swsn-1p::swsn-1::unc-54 UTR::loxN::NLS::GFP::let-858 UTR + unc-119(+)] V. heSi141 [hlh-8(short)::FLAG::CRE::tbb-2 + unc-119(+)] X. Maintain the line at 15C and shift to 25C for mutant analysis. Expression of CRE recombinase in the mesoblast lineage driven by the hlh-8 promoter. heSi164 carries a swsn-1 rescue construct which ensures rescue of the temperature-sensitive swsn-1(os22) mutation. Upon expression of CRE (in this case in the mesoblast lineage) the swsn-1 gene will be excised, creating a mesoblast specific mutant of swsn-1. This recombination event can be visualized by a switch from red to green in those mesoblast cells in which swsn-1 was lost. The animals are healthy at 15C, but embryonic lethal and larval arrested at 23-25C. swsn-1(os22) causes mild overproliferation in the mesoblast lineage. The swsn-1 rescuing transgene is unable to rescue germline development of swsn-1(os22) mutants. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
|
|
| SWF117 |
C elegans |
flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF142 |
C elegans |
mod-1(ok103) V; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF150 |
C elegans |
ser-5(tm2647) I; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF154 |
C elegans |
ser-1(ok345) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|
| SWF155 |
C elegans |
ser-7(tm1325) X; flvIs2. Show Description
flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
|
|