Strain Information

Name MCJ583   View On Wormbase
Species C. elegans
Genotypealg-1(cdb153[D740A]) X.
Descriptioncdb153 is an engineered D740A substitution in the short isoform of alg-1, mutating the DDH catalytic triad to ADH. Catalytically inactive allele of alg-1. sgRNA #1: GACATCACTCATCCACCAGC; sgRNA #2: GCTACCATAGGCACCACGAG. sgRNA #2 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816.
MutagenCrispr/Cas9
Outcrossedx0
Made byKatherine McJunkin
Laboratory MCJ
Reference Kotagama K, et al. Nucleic Acids Res. 2024 May 22;52(9):4985-5001. doi: 10.1093/nar/gkae170. PMID: 38471816.
Sign in or register an account if you want to order this strain.