Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB2593 C. elegans F47G4.2(ok3615) I. Show Description
F47G4.2 Homozygous. Outer Left Sequence: ggaattgagacacccgaaaa. Outer Right Sequence: gggcacaaatcaattttcca. Inner Left Sequence: ttttcggcaaattgtggttt. Inner Right Sequence: gactgcgatgtaaaggcg. Inner Primer PCR Length: 1243. Estimated Deletion Size: about 300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB929 C. elegans tdp-1(ok803) II. Show Description
F44G4.4 Homozygous. Outer Left Sequence: TTTCCCTGTCGGTTTTGAAC. Outer Right Sequence: GTGAACACGAGTTCCGAGGT. Inner Left Sequence: TTTTGCTCGGAGATTTTTGG. Inner Right Sequence: TGTGAACACGACGCCATACT. Inner Primer PCR Length: 2144. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB947 C. elegans zyx-1(ok834) II. Show Description
F42G4.3b. Homozygous. Outer Left Sequence: AAACCTTTACGCAACGATGG. Outer Right Sequence: TGGAAGGAAGGGGAGATTTT. Inner Left Sequence: CGAGCTTGAATGTTTCACGA. Inner Right Sequence: TAAACTATGATCCCTGCGCC. Inner Primer WT PCR Product: 2803. Deletion size: 599 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3338 C. elegans C25G4.2(ve838[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 673 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GCTCTCTCATAAATCCGGCAATCTTCTCCT ; Right flanking sequence: AGGCAGAGGATCCGGAGTTTCGGTTGGGAA. C25G4.2 sgRNA #1: ACCGTCGATGTCAAAGCACA; C25G4.2 sgRNA #2: CGCATTGTCGATATCCGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3534 C. elegans pigq-1(ve1034[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1274 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTTTTTAATTTTCACGAAAAGATGTTATT ; Right flanking sequence: TGGACTGTATTAATTGAACTACCCAATTGA. pigq-1 crRNA A: TTTCAATCAAGCTTCCCATT; pigq-1 crRNA B: AACGGTAAAACGAGCGAGGG. Note:The crRNA B target is in the predicted 3' UTR of an allele of F01G4.6. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RW10609 C. elegans unc-119(ed3) III; zuIs178 V; stIs10024; stIs10681. Show Description
zuIs178 [his-72(1kb 5' UTR)::his-72::SRPVAT::GFP::his-72 (1KB 3' UTR) + 5.7 kb XbaI - HindIII unc-119(+)]. stIs10024 [pie-1::H2B::GFP::pie-1 3' UTR + unc-119(+)]. stIs10681 [T23G4.1::H1-wCherry + unc-119(+)].
RW11459 C. elegans unc-119(tm4063) III; stIs11459. Show Description
stIs11459 [F20G4.1::H1-wCherry + unc-119(+)].
RW11908 C. elegans unc-119(tm4063) III; stIs11908. Show Description
stIs11908 [F58G4.4::H1-wCherry + unc-119(+)].
TH175 C. elegans unc-119(ed3)III; ddIs97. Show Description
ddIs97 [F47G4.6::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TX585 C. elegans unc-119(ed3) III; teIs18 V. Show Description
teIs18 [sdz-23p::GFP::H2B::pie-1 3'UTR + Cbr-unc-119(+)]. Superficially wild-type. Integrated array carrying sdz-23 (F58G4.4) promoter fusion with bright GFP expression in E cell. Reference: Shetty P, et al. Dev Biol. 2005 Sep 15;285(2):584-92.
VC1144 C. elegans +/szT1 [lon-2(e678)] I; cas-1(ok1523)/szT1 X. Show Description
F41G4.2. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1523 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1693 C. elegans C30G4.7(gk806) X. Show Description
C30G4.7. External left primer: TTGGATGGGGATACACCAGT. External right primer: TTTTCCCGGTTCACTTTCAC. Internal left primer: GTCATTGGGAATTGTTCGCT. Internal right primer: GCCAGGTTCGTGAGAGGTAG. Internal WT amplicon: 1951 bp. Deletion size: 857 bp. Deletion left flank: CCTTCTATTTCTGTCTCCCCCCCATAAATA. Deletion right flank: TGCCACATGGTTAGTAAAACTGGGTGGTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1737 C. elegans F43C11.2(gk3131) II; F13A2.3(gk3132) V; W07E11.1(gk3133) F41G4(gk840) X. Show Description
This strain is homozygous for a deletion (gk840) in F41G4.1, detectable by PCR using the following primers. External left primer: TCGTTCTTTCGTAAAACCCG. External right primer: TTCTGGCTTAAGCTGCCAAT. Internal left primer: GAAGGCAAATTGCTCAGCTC. Internal right primer: TTCAATGTGATCGTCTTCGC. Internal WT amplicon: 1889 bp. Deletion size: 925 bp. Deletion left flank: TGCAGTGTAGAGTCGGGTCAAAAAGACAAG. Deletion right flank: AAGATCAACTACACCAGTCCAATTTTCAAT. Insertion Sequence: ATCAACAAA. Validation: No CGH probes for gk840. Other deletions (gk3131, gk3132, gk3133) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1872 C. elegans W07G4.4(ok1223) V. Show Description
W07G4.4. External left primer: TAGCCTGCCATCTCTTTTGC. External right primer: GGGGCGAATGATAAGAAACA. Internal left primer: CTTTTGATGCTGTCGTGCTC. Internal right primer: AAACGTGAGGAAGCACAAGG. Internal WT amplicon: 2105 bp. Deletion size: 1522 bp. Deletion left flank: AAACGTGCGGAGGAAAGCATAGATCAGCAT. Deletion right flank: CCATCAGTTAGCTTCCCTAATCCACTTGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1905 C. elegans F21G4.5(gk1035) X. Show Description
F21G4.5. External left primer: TTGATGGAACTTTCATGGCA. External right primer: ATGATCTGAGATGAACGGGG. Internal left primer: CCTCTAAATGCCGACGTTGT. Internal right primer: TCCTGATCAATTGCAGCATC. Internal WT amplicon: 1653 bp. Deletion size: 444 bp. Deletion left flank: TTGCAGGTACATTTTCCTTGGTGAACATAA. Deletion right flank: ACTTTTTTCCATGTCTCCCACAACGTAAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1985 C. elegans F47G4.6(gk1056) I; daf-3(gk3330) X. Show Description
This strain is homozygous for a deletion (gk1056) in F47G4.6, detectable by PCR using the following primers. External left primer: CGCTTCTCCTGAGGTAGTGG. External right primer: GGACACTTCGAACCGGATTA. Internal left primer: ACGATGGATCGGTGTTTCTC. Internal right primer: AGCTGCCTAGCCTTCTCCTC. Internal WT amplicon: 1914 bp. Deletion size: 457 bp. Deletion left flank: TTAGCCTAAAAAATTTTTCCGAATTTTCTC. Deletion right flank: AGCTACCGTACTCATAAGCTACAGAGTGTA. Validation: gk1056 passed by diagnostic PCR and CGH. Other deletion (gk3330) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC299 C. elegans zyx-1(gk190) II. Show Description
F42G4.3b. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3016 C. elegans ZK354.2(gk1288) F01G4.3(gk3110) IV. Show Description
This strain is homozygous for a deletion (gk1288) in ZK354.2, detectable by PCR using the following primers. External left primer: GCCTCCCCCTATCGATAAAC. External right primer: TCGTCTTGTTGTTCTTCCCC. Internal left primer: TGAACATGAAGAGCTCGGTG. Internal right primer: GTACCCGGGACCCTTGTAAT. Internal WT amplicon: 1294 bp. Deletion size: 770 bp. Deletion left flank: AACATGAAGAGCTCGGTGAGTTATTGATGG. Deletion right flank: CCAAGAAAAACGATGAAGCTGAGGAGCAGA. Validation: gk1288 passed by CGH. Other deletion (gk3110) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3196 C. elegans smgl-1(ok2423) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F20G4.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2423 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAACCAATCCAGCTTTTC. External right primer: CCAAAACGAGAAGACGGAGA. Internal left primer: TTCGACTTTTTCGGCGAT. Internal right primer: ATGGAACATCCTGATGCTGA. Internal WT amplicon: 1173 bp. Deletion size: 637 bp. Deletion left flank: TTCTAAAAATAATTAAATTAGAGTGTTAAA. Deletion right flank: CGTATGGTTGCCACGTCGCGAGATCATGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC334 C. elegans hyl-1(gk203) IV. Show Description
C09G4.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC384 C. elegans ooc-5(ok604)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F44G4.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok604 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC386 C. elegans nmy-2(ok499)/hT2 I; +/hT2 [bli-4(e937)] III. Show Description
F20G4.3. Heterozygotes are WT, and segregate WT, arrested hT2 aneuploid progeny, Bli hT2 homozygotes, and homozygous ok499 hermaphrodites (arrest stage/phenotype undetermined). The bli-4 mutation does not express until the adult, and is sometimes extremely subtle. Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3974 C. elegans C06G4.1(gk5052[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2869 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAAAGACAAATCGATATTTGTATCCAGCG; Right flanking sequence: TCTTCCAAGTTCGTGTTCCAGAAAACATGG. See WormBase Variation gk5052 for details.
VC4888 C. elegans F56G4.4(gk5956[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4818 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TTAAAATTCATTAAATTCGAATTAAATTAA. Right flanking sequence: GGGCTCATTGAGCCCCCAAAACCATCAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC549 C. elegans tdp-1(ok781) II. Show Description
F44G4.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC611 C. elegans F44G4.1(ok839)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F44G4.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok839 homozygotes (larval arrest). Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC712 C. elegans mrp-4(ok1095) X. Show Description
F21G4.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC906 C. elegans zyx-1(gk442)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
F42G4.3a. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk442 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
AG400 C. elegans fasn-1(av138[fasn-1::gfp]) I. Show Description
Homozygous viable, gfp expression in intestine, hypodermis, developing vulva, somatic gonad. Reference: Starich et al. eLife 2020;9:e58619. DOI: https://doi.org/10.7554/eLife.58619
AG406 C. elegans pezo-1(av144) IV. Show Description
av144 is a CRISPR/Cas9 engineered deletion in the N-terminal region of pezo-1 removing exons 1–13. Small brood size. Reference: Bai X, et al. Elife. 2020 Jun 3:9:e53603. doi: 10.7554/eLife.53603. PMID: 32490809.
AG416 C. elegans pezo-1(av149) IV. Show Description
av149 is a CRISPR/Cas9 engineered deletion in the C-terminal region of pezo-1 removing the last seven exons (27–33) and introns. Small brood size. Reference: Bai X, et al. Elife. 2020 Jun 3:9:e53603. doi: 10.7554/eLife.53603. PMID: 32490809.
AMJ565 C. elegans jamSi6 II; rde-4(ne301) III. Show Description
jamSi6 [nas-9p::rde-4(+)::rde-4 3' UTR + unc-119(+)] II. Enables RNAi silencing in body wall muscles in an otherwise rde-4(ne301) background. jamSi6 was integrated into ttTi5605 II in an EG4322 background using MosSCI. Unknown if unc-119(ed9) is still present or homozygous in background. An isolated inserted line was crossed into AMJ8 (juIs73 [unc-25p::GFP] III) to temporarily balance the endogenous rde-4 locus during the subsequent cross; resulting jamSi6 heterozygous males were crossed into WM49 (rde-4(ne301) III). rde-4(ne301) presumed to be homozygous in this strain due to crossing strategy and minimal recombination between rde-3 and juIs73. Reference: Raman P, et al. Nucleic Acids Res. 2017 Aug 21;45(14):8463-8473. doi: 10.1093/nar/gkx484. PMID: 28541563.
AMJ912 C. elegans jamSi28 II; rde-4(ne301) III. Show Description
jamSi28 [myo-3p::rde-4(+)::rde-4 3' UTR + unc-119(+)] II. Enables RNAi silencing in body wall muscles in an otherwise rde-4(ne301) background. jamSi28 was integrated into ttTi5605 II in an EG4322 background using MosSCI. Unknown if unc-119(ed9) is still present or homozygous in background. An isolated inserted line was crossed into AMJ8 (juIs73 [unc-25p::GFP] III) to temporarily balance the endogenous rde-4 locus during the subsequent cross; resulting jamSi28 heterozygous males were crossed into WM49 (rde-4(ne301) III). rde-4(ne301) presumed to be homozygous in this strain due to crossing strategy and minimal recombination between rde-3 and juIs73. Reference: Raman P, et al. Nucleic Acids Res. 2017 Aug 21;45(14):8463-8473. doi: 10.1093/nar/gkx484. PMID: 28541563.
BB95 C. elegans dcr-1(ok247) III; uuEx21. Show Description
uuEx21 [dcr-1(G492R) + dpy-30::mCherry]. Temperature-sensitive, sterile at 25C. Reference: Welker N, et al. (2010) RNA 16:893-903.
BCN2081 C. elegans crgSi2081 II; unc-119(ed3) III. Show Description
crgSi2081 [rpl-28p::PuroR + myo-2p::GFP + Cbr-unc-119(+)] II. Superficially wild-type. Puromycin resistant. ttTi5605 transposon in EG4322 has been replaced by a single copy insertion crgSi2081. Reference: Semple JI, et al., Nat Methods. 2010 Sep;7(9):725-7.
BN195 C. elegans bqSi195 II. Show Description
bqSi195 [(pBN65) hsp-16.41p::Dam::Myc::lmn-1 + unc-119(+)] II. Strain for DamID mapping of chromatin associated with the nuclear lamina/LMN-1. Made by MosSCI using strain EG4322 for injection. Might still carry unc-119(ed9) III, which is rescued by bqSi195. Reference: González-Aguilera C, et al. Genome Biol. 2014 Feb 3;15(2):R21.
BN196 C. elegans bqSi196 II. Show Description
bqSi196 [hsp-16.41p::GFP::Myc::Dam + unc-119(+)] II. Strain for DamID mapping of chromatin associated with the nuclear lamina/LMN-1. Made by MosSCI using strain EG4322 for injection. Might still carry unc-119(ed9) III, which is rescued by bqSi196. Reference: González-Aguilera C, et al. Genome Biol. 2014 Feb 3;15(2):R21.
BN218 C. elegans bqSi218 II. Show Description
bqSi218 [hsp-16.41p::Dam::Myc::emr-1 + unc-119(+)] II. Strain for DamID mapping of chromatin associated with the nuclear lamina/LMN-1. Made by MosSCI using strain EG4322 for injection. Might still carry unc-119(ed9) III, which is rescued by bqSi218. Reference: González-Aguilera C, et al. Genome Biol. 2014 Feb 3;15(2):R21.
CG1438 C. elegans egl-2(rg444) him-5(e1490) V. Show Description
rg444 is an endogenous genomic CRISPR/Cas9 knock in of YFP fused to the C-terminus of the EGL-2 K+ Channel in N2 background. Faint YFP fluorescent puncta can be detected on muscle membranes and neural cell bodies and processes at high power magnification in all stages. Him. Reference: Goncalves J, et al. iScience 2020 Mar 19;23(4):100990. PMID: 32240955
CG460 C. elegans unc-43(sy574) IV; him-5(e1490) V; rgEx161. Show Description
rgEx161[lev-11p::UNC-43g + gtl-1p::CFP]. rgEx161 rescues unc-43(sy574)-induced spicule protraction.
CG499 C. elegans daf-2(e1368) unc-103(n1213) III; him-5(e1490) V; rgEx178. Show Description
rgEx178 [lev-11p::daf-2(+) + lev-11p::GFP]. rgEx178 rescues food deprivation suppression of unc-103(n1213)-induced spicule protraction.
CGC58 C. elegans C54E10.3(umn2[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 745 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgtacccccgatgggattcgaacctgtggc ; Right flanking sequence: gggtatgcaaaatgaccgcgttttctgtga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC59 C.elegans gnrr-7(umn3[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1004 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttctggtttaaagccgcaaagtcttgg ; Right flanking sequence: agggtaccatcaagcaatggcattctggtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC61 C. elegans F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC72 C. elegans npr-23(umn5[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 280 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGGCGTCATCTGGAGAGAAGAACGAAgtg ; Right flanking sequence: CGGACACTTGTGCTTCACCAACTTGATCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC73 C. elegans npr-28(umn6[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TATTTGGTATCATTTTTCTAGCCGACTTTC ; Right flanking sequence: TGGACTTGTTTTCACTCATCCCTGTACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC78 C. elegans C04C3.6(umn8[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1123 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcaactatttttaatgaaaatttca ; Right flanking sequence: TGGTCACTTTACCTGCGTTGATATTCATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CGC81 C. elegans C09F12.3(umn9[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozgous viable. Deletion of 1171 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acaatttacattaacttttcattatttcag ; Right flanking sequence: tggatgtgcattttttcgctgctcactctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
CH1179 C. elegans unc-36(e251) emb-9(g23cg46)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and 3-fold lethals. cg46 is a 497 bp deletion that removes the last 22 nucleotides of intron 9 and 475 nucleotides of exon 10;
CV203 C. elegans rjSi1 II. Show Description
rjSi1 [cra-1p::cra-1::GFP::cra-1 3'UTR + Cbr-unc-119(+)] II. Single copy insertion. cra-1 promoter, cra-1::GFP and 3'UTR was cloned into pCFJ150 (ttTi5605) vector and inserted into ttTi5605 of EG4322 strain. Outcrossed three times to N2 Bristol; could still carry unc-119(ed9) in the background. Superficially wild-type. This CRA-1::GFP fusion construct has been shown to be functional and its localization reflects endogenous CRA-1 localization. rjSi1 transgene can rescue synapsis defects of cra-1 mutants and restore cross-over events (six bivalents instead of the 11 to 12 univalents characteristic of cra-1 mutants). Brood size and embryonic lethality were significantly, albeit not completely, restored in the rescued line suggesting that the GFP tag might affect other CRA-1 functions. Reference: Gao J, et al. PLOS Genetics 11(3): e1005029. https://doi.org/10.1371/journal.pgen.1005029