| RB69 |
C. elegans |
okIs65. Show Description
okIs65 . Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
|
|
| RG3395 |
C. elegans |
+/nT1 [umnIs49] IV; rpb-9(ve895[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Apparently semi-sterile. Deletion of 753 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate apparently semi-sterile adults (ve895 homozygotes) can be maintained as a homozygote with difficulty, Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GGGAGCGTTGGATCGTGAATAATATCTCCG; Right flanking sequence: TGGCTCATCTTTCTGAAAAAATATGATAAA. rpb-9 sgRNA A: AGTGAGCTCACTCAAATCGT; rpb-9 sgRNA B: CATCGTAATTATCATACCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RW12257 |
C. elegans |
mab-9(st12257[mab-9::TY1::EGFP::3xFLAG]) II. Show Description
CRISPR/Cas9 engineered tagged endogenous locus.
|
|
| RW3539 |
C. elegans |
emb-9(st545)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs.
|
|
| SL438 |
C. elegans |
spe-9(eb19) I; him-5(e1490) V; ebEx126. Show Description
ebEx126 [YAC Y47H9 [spe-9(+)] + rol-6(su1006)]. Pick Rollers to maintain. eb19 is a spe-9 non-conditional mutant.
|
|
| SL536 |
C. elegans |
dxDf2/spe-9(eb19) unc-101(m1) I. Show Description
Heterozygotes are Unc and segregate Uncs, Sterile Uncs and dead eggs. Strain is sick and grows slowly. dxDf2 fails to complement unc-54, so it could delete the entire right arm of LG I.
|
|
| SYS610 |
C. elegans |
mab-9(dev182([mNeonGreen::mab-9]) ujIs113 II. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of mab-9 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
|
|
| VC1232 |
C. elegans |
nhr-122(gk560) IV. Show Description
Y41D4B.9. External left primer: AACGAGGTCTCGACTGTGCT. External right primer: CTTTTCCTTTTCTACCCCCG. Internal left primer: ATTCGGAAAGAATTTGCACG. Internal right primer: TTTCAGTCTGGGATGGGTTT. Internal WT amplicon: 2011 bp. Deletion size: 1537 bp. Deletion left flank: AGAATATTGTTTGTCTGTCCGTTTTTTTTT. Deletion right flank: AGCTGCTCTAAAATCTCCTTGCAGAAAATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1907 |
C. elegans |
Y97E10AR.7&rpb-9(gk1044) V/nT1 [qIs51] (IV;V). Show Description
Y97E10AR.5, Y97E10AR.7. Homozygous semi-sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk1044 homozygotes (often sterile or nearly sterile, can be maintained). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTATGAAGCTTAGCGCGGAC. External right primer: GACCATTGACACCTCGACCT. Internal left primer: TGCCAGAAGCATTGTACGAG. Internal right primer: GGATGGGTTAACTGGGATGA. Internal WT amplicon: 1933 bp. Deletion size: 931 bp. Deletion left flank: TAGACTGATTATGAGCATGTTTTAAAAAAT. Deletion right flank: TTTTGTTCCAACATTTTTAGTTTAAAATTA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2273 |
C. elegans |
Y105E8B.9(ok3031) I. Show Description
Y105E8B.9. External left primer: TCTTGAGTTGTTCGTGGCTG. External right primer: CCACACAGTACCCTCACTGC. Internal left primer: GGCATGAATTCTCCATCGTC. Internal right primer: TCCCTTTTTAGTTTTACCTACCGA. Internal WT amplicon: 1214 bp. Deletion size: 737 bp. Deletion left flank: CAACTATAAAACACAACACCAAATGTTGAG. Deletion right flank: TACCTCAAATTAAGTAATTTATTTTTCGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC4455 |
C. elegans |
Y6B3B.9(gk5530[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 7960 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GCTTTTTCCGCTTGTGAGCCAGTGTTGTGC. Right flanking sequence: TTTGGTGAGTGAATAAGTAATTGAAAAACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC4810 |
C. elegans |
Y43F4B.9(gk5878[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 4131 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: TAGACTCGAAATTTGGCGGTTTTGGAGCCA. Right flanking sequence: GAAGCTACAGTACTCCTTGAAGGCACACGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VC637 |
C. elegans |
ebp-3(ok998) V. Show Description
Y59A8B.9. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| WH408 |
C. elegans |
sep-1(e2406) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous embryonic lethal mutation balanced by bli-4- and GFP-marked translocation. Maintain at 15 C. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP e2406 homozygotes (embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Bembenek J, et al. Curr Biol (2010) Feb 9;20(3):259-64.
|
|
| WH468 |
C. elegans |
sep-1(e2406) I/hT2 (I;III); ruIs32 III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Homozygous embryonic lethal mutation balanced by bli-4- and GFP-marked translocation. Maintain at 15 C. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP e2406 homozygotes (embryonic arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Bembenek J, et al. Curr Biol (2010) Feb 9;20(3):259-64.
|
|
| WH485 |
C. elegans |
sep-1(e2406) I/hT2 (I;III); ojIs58 III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ojIs58 [pie-1p::sep-1::GFP + unc-119(+)] III. Homozygous embryonic lethal mutation balanced by bli-4- and GFP-marked translocation. Maintain at 15 C. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP e2406 homozygotes (embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Bembenek J, et al. Curr Biol (2010) Feb 9;20(3):259-64.
|
|
| XE2411 |
C. elegans |
unc-116(rh24sb79) III; oyIs14 V. Show Description
oyIs14 [sra-6p::GFP + lin-15(+)]. Disrupted mitochondrial trafficking. sb79 is an intragenic suppressor of the rh24 gain-of-function allele. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.
|
|