More Fields
Strain Species Genotype
VC1232 C. elegans nhr-122(gk560) IV. Show Description
Y41D4B.9. External left primer: AACGAGGTCTCGACTGTGCT. External right primer: CTTTTCCTTTTCTACCCCCG. Internal left primer: ATTCGGAAAGAATTTGCACG. Internal right primer: TTTCAGTCTGGGATGGGTTT. Internal WT amplicon: 2011 bp. Deletion size: 1537 bp. Deletion left flank: AGAATATTGTTTGTCTGTCCGTTTTTTTTT. Deletion right flank: AGCTGCTCTAAAATCTCCTTGCAGAAAATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC4529 C. elegans eif-2Bepsilon(gk5600[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2890 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAAATTTTGCAGATGCAATGACGCCCTACC. Right flanking sequence: CTTGTTATGACTGAAAGTTTTCAACCACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4530 C. elegans D2089.3(gk5601[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 2409 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTAGATTGACGAAAACAGGTATTTGACG. Right flanking sequence: ACCGGAAATACGTAGATATAACACGAAAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4531 C. elegans suox-1(gk5602[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ X. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2222 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AGATGAGACGATGTCAGAGAAGAAATTGGA. Right flanking sequence: ATAGAGTTCCCATTATTGTGAAGGATTAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4532 C. elegans tdpt-1(gk5603[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 3196 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTTTATTTGTCTCTTCGCTTTTACCTCAT. Right flanking sequence: TTGCAATCCTGGCACGCGTGTTGCAACTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4533 C. elegans D2024.5(gk5604[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 897 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAGCGACTGAATGGAGAATTATTATGACAA. Right flanking sequence: TGAGGTTTTGCATCTGAATTTTCTTCAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4534 C. elegans pdxk-1(gk5605[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2333 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TACATACATATGGATTAAAGGGGACCCAGA. Right flanking sequence: CGAGGAAGGACCTGCTTTGGCCGCCAACGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4535 C. elegans eif-3.F(gk5606[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1569 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GGCTTCGAATTTAACTGTCAATGTCCACCC. Right flanking sequence: CCCTCCCGAATTTGAAATTAGCGTTTCCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4537 C. elegans thk-1(gk5608[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1893 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAGTATTTAGATAAGACATTAAGTCCGAGC. Right flanking sequence: CAGTTAGTTGGATCTGGAATTATTGCTAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4538 C. elegans sss-1(gk5609[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGTTATAGAGAGAGGTTTAGAGAGAGAGCA. Right flanking sequence: AGGTTTAAGGTTTAAAAAATGCGACAAAGACATTTTTTGGACAATATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.