More Fields
Strain Species Genotype
ABR9 C. elegans set-2(ok952) III; rbr-2(tm1231) IV. Show Description
Reduced lifespan. Maintain under normal conditions. The parental rbr-2 strain was outcrossed 6x and the parental set-2 strain was outcrossed 2x. Reference: Greer EL et al Nature (2010) doi: 10.1038/nature09195.
AX1410 C. elegans flp-18(db99) X. Show Description
Impaired chemotaxis and foraging behavior. Excess intestinal fat accumulation. Reduced oxygen consumption. Derived from NL4000. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.
BB19 C. elegans adr-1(tm668) I. Show Description
Reduced lifespan, chemotaxis defective, co-suppression of transgenes in somatic cells. Maintain under normal conditions. Reference: Hundley HA, et al. RNA. 2008 Oct;14(10):2050-60.
BE109 C. elegans ?(sc109) V. Show Description
As homozygote suppresses blister formation in bli-1(sc73), bli-2(sc768) and bli-6(sc16). WT phenotype. Males sometimes have small blisters above their bursas. Males mate well. See wbg9.1p51.
BOX218 C. elegans erm-1(mib19[erm-1[T544A]::GFP]) I. Show Description
Homozygous viable. Endogenous erm-1 locus tagged with eGFP and modified to mimic non-phosphorylated ERM-1(T544). Variant affects ERM-1 localization and dynamics. Reduced brood size, increased embryonic and larval lethality. eGFP-tagged ERM-1 is not fully functional: animals have a reduced brood size and incomplete outgrowth of the excretory canal, but show no other developmental or morphological abnormalities. The penetrance of intestinal phenotypes is slightly higher than in untagged T544 mutants, presumably owing to a detrimental influence of the COOH-terminal GFP tag. Reference: Ramalho JJ, et al. Development. 2020 Jul 22;147(14):dev188011. PMID: 32586975
CB3297 C. elegans vab-9(e1744) II; him-5(e1490) V. Show Description
Him. M-MATING+POOR <1%WT. Tail abnormalities->knob-like swelling in larvae and adults.
CB3353 C. elegans mab-9(e1245) II; him-5(e1490) dpy-21(e428) V. Show Description
Hermaphrodites are Dpy and segregates males. Males are non-Dpy and have severe tail abnormalities; frequently lethal to adult males.
CB4605 C. elegans mab-9(e2410) II; him-5(e1490) V. Show Description
CB49 C. elegans unc-8(e49) IV. Show Description
CB7403 C. elegans bah-3(br9) I; bah-2(gk487599) IV. Show Description
Bah (resistant to Yersinia biofilm formation). Reference: Hodgkin et al (in preparation).
CH1179 C. elegans unc-36(e251) emb-9(g23cg46)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and 3-fold lethals. cg46 is a 497 bp deletion that removes the last 22 nucleotides of intron 9 and 475 nucleotides of exon 10;
CH1180 C. elegans unc-32(e189) emb-9(cg56)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and Uncs which arrest in the L1 stage.
DA589 C. elegans unc-32(e189) emb-9(hc70) III. Show Description
Unc. Temperature sensitive. Maintain at 15C. hc70 is semi-dominant.
DC9 C. elegans bah-3(br9) I. Show Description
Bah (biofilm absent on head - resistant to attachment of Yersinia sp. biofilms). Cld: constitutive larval display of epitope recognized by monoclonal antibody M37.
DH117 C. elegans emb-9(b117) III. Show Description
Temperature sensitive. Semi-dominant. Egg lethal. Not maternal. Will grow at 20C.
DH189 C. elegans emb-9(b189) III. Show Description
Temperature sensitive. Egg lethal. Maternal effect (m,n). Acc and Gon. Some growth at 20C, but not at 25C.
DH89 C. elegans zyg-5(b89) II. Show Description
Temperature senstive. No growth at 20C or 25C. Weakly semidominant. Egg lethal.
GE1709 C. elegans vab-9(e1744) unc-4(e120) II; him-5(e1490) V. Show Description
Unc. Slightly Dpy. Tail whip knobbed at all stages except adult male (adult male tail tip slightly swollen). Variably Egl.
GE1711 C. elegans dpy-2(e8) vab-9(e1744) unc-4(e120) II. Show Description
Dpy. Unc. Tail whip knobbed at all stages except adult male (adult male tail tip slightly swollen).
GE1712 C. elegans vab-9(e1744) rol-6(e187) unc-4(e120) II. Show Description
Unc. Roller. Tail whip knobbed at all stages except adult male (adult male tail tip slightly swollen).
GG23 C. elegans emb-9(g23) III. Show Description
Temperature sensitive. Maintain at 15C, will not grow at 25C.
GG34 C. elegans emb-9(g34) III. Show Description
Temperature sensitive. Maintain at 15C. At 25C the animals die as pretzels; a few hatch and die as L1. Will grow at 20C.
HW1329 C. elegans lin-41(xe11) I. Show Description
Egg-laying (Egl) defects and subsequent internal hatching of progeny (Bagging) in > 95% of animals. xe11 is a C-to-U point mutation in each of the endogenous let-7 complementary sites, LCS1 and LCS2 [I:C9,335,211T & I:C9,335,260T]. xe11 is a weak gain-of-function allele: mutation of two functionally relevant let-7 binding sites impairs repression by let-7 causing over-expression of LIN-41 in L4 stage animals. Reference: Ecsedi M, et al. Dev Cell. 2015 Feb 9;32(3):335-44. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JUb19 Stenotrophomonas maltophilia Stenotrophomonas maltophilia Show Description
MCJ219 C elegans sup-26(cdb99) nhl-2(cdb100) III; egl-1(cdb97) V. Show Description
nhl-2(cdb100) contains engineered mutations in the mir-35 binding site in the nhl-2 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the egl-1 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Slightly reduced brood size at 25C. Reference: Donnelly BF, et al. (2022). Cell Reports.
MJ70 C. elegans emb-9(hc70) III. Show Description
Temperature sensitive egg lethal. Maintain at 15C. Some growth at 20C, no growth at 25C.
MLC1389 C. elegans lucEx824. Show Description
lucEx824 [mab-9::T2A::GFP::H2B::mab-9 3'UTR + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Wild-type morphology. Extrachromosomal mab-9 reporter includes 3.1 kb of mab-9 upstream region and 1.5 kb of downstream region. Reference: Charest J, et al. Dev Cell. 2020 Sep 24;S1534-5807(20)30672-9. PMID: 33002421
NK2326 C. elegans emb-9(qy24[emb-9::mNG+loxP]) III. Show Description
Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2585 C. elegans emb-9(qy83[emb-9::mRuby2 + LoxP]) III. Show Description
mRuby2G tag inserted into the endogenous emb-9 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
NK2604 C. elegans emb-9 (qy89[emb-9::mEos2+loxP]) III. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2651 C. elegans lin-35(n745) I; emb-9(qy83[emb-9::mRuby2 + LoxP]) III. Show Description
CRISPR/Cas9 insertion of mRuby2G into the endogenous emb-9 locus (internal tag) in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
NK2920 C. elegans emb-9(qy83[emb-9::mRuby2 + LoxP]) III; gon-1(qy45[gon-1::mNG+LoxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous gon-1 locus and mRuby2G tag inserted into the endogenous emb-9 locus (internal tag). Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
NK364 C. elegans unc-119(ed3) III; qyIs46. Show Description
qyIs46 [emb-9p::emb-9::mCherry + unc-119(+)] X. Superficially wild-type with very low penetrance (~5%) rupture. Integrated collagen::mCherry reporter. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.
NK860 C. elegans unc-119(ed4) III; qyIs161. Show Description
qyIs161 [emb-9p::emb-9::Dendra + unc-119(+)]. Reference: Ihara S, et al. Nat Cell Biol. 2011 Jun;13(6):641-51.
OC199 C. elegans zyg-1(it25) sds-22(bs9) II. Show Description
it24 is temperature sensitive; produces maternal effect embryonic lethal phenotype (Mel) after shoft to 24C at L4 stage. Mel is partially suppressed by bs9 at 24C. sds-22 previously called szy-6. Reference: Kemp C, et al. (2007) Genetics 176:95-113.
OH12389 C. elegans mab-9(ot788) II; hdIs1 X. Show Description
hdIs1 [unc-53p::GFP + rol-6(su1006)] X. Rollers. De-repression of ectopic effector genes in DA/DB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH14357 C. elegans mab-9(ot863[mab-9::TagRFP::AID]) II. Show Description
mab-9(ot863[mab-9::TagRFP::AID]) II. mab-9 was modified by CRISPR/Cas9 to create a conditional allele using the auxin-inducible degron (AID). RFP is not visible in this strain. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH15276 C. elegans pha-1(e2123) III; otEx7107. Show Description
otEx7107 [inx-1b(fosmid WRM0672aB09)::SL2::NLS::YFP::H2B + pha-1(+) + myo-2p::BFP]. Maintain at 25C or pick BFP+ to retain array. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
PB49 C. elegans egl-5(n486) unc-36(e251) III; him-5(e1490) V. Show Description
Unc and Egl. Throws males.
QQ251 C. elegans vab-9(ju6) II; mcIs50. Show Description
mcIs50 [lin-26p::vab-10(actin-binding domain)::GFP + myo-2p::GFP + pBluescript]. Variably Abnormal with body shape defects and bobbed tail at all stages. Reference: Vuong-Brender TTK, et al. PLoS One. 2018 Feb 21;13(2):e0193279.
QQ258 C. elegans vab-9(ju6) II. Show Description
Tail whip knobbed at all stages except adult male (adult male tail tip slightly swollen). Reference: Simske JS, et al. Nat Cell Biol. 2003 Jul;5(7):619-25.
RB69 C. elegans okIs65. Show Description
okIs65 . Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.
RG3395 C. elegans +/nT1 [umnIs49] IV; rpb-9(ve895[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Apparently semi-sterile. Deletion of 753 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate apparently semi-sterile adults (ve895 homozygotes) can be maintained as a homozygote with difficulty, Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GGGAGCGTTGGATCGTGAATAATATCTCCG; Right flanking sequence: TGGCTCATCTTTCTGAAAAAATATGATAAA. rpb-9 sgRNA A: AGTGAGCTCACTCAAATCGT; rpb-9 sgRNA B: CATCGTAATTATCATACCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RW12257 C. elegans mab-9(st12257[mab-9::TY1::EGFP::3xFLAG]) II. Show Description
CRISPR/Cas9 engineered tagged endogneous locus.
RW3539 C. elegans emb-9(st545)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs.
SL438 C. elegans spe-9(eb19) I; him-5(e1490) V; ebEx126. Show Description
ebEx126 [YAC Y47H9 [spe-9(+)] + rol-6(su1006)]. Pick Rollers to maintain. eb19 is a spe-9 non-conditional mutant.
SL536 C. elegans dxDf2/spe-9(eb19) unc-101(m1) I. Show Description
Heterozygotes are Unc and segregate Uncs, Sterile Uncs and dead eggs. Strain is sick and grows slowly. dxDf2 fails to complement unc-54, so it could delete the entire right arm of LG I.
SYS610 C. elegans mab-9(dev182([mNeonGreen::mab-9]) ujIs113 II. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of mab-9 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
VC1232 C. elegans nhr-122(gk560) IV. Show Description
Y41D4B.9. External left primer: AACGAGGTCTCGACTGTGCT. External right primer: CTTTTCCTTTTCTACCCCCG. Internal left primer: ATTCGGAAAGAATTTGCACG. Internal right primer: TTTCAGTCTGGGATGGGTTT. Internal WT amplicon: 2011 bp. Deletion size: 1537 bp. Deletion left flank: AGAATATTGTTTGTCTGTCCGTTTTTTTTT. Deletion right flank: AGCTGCTCTAAAATCTCCTTGCAGAAAATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1907 C. elegans Y97E10AR.7&rpb-9(gk1044) V/nT1 [qIs51] (IV;V). Show Description
Y97E10AR.5, Y97E10AR.7. Homozygous semi-sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk1044 homozygotes (often sterile or nearly sterile, can be maintained). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTATGAAGCTTAGCGCGGAC. External right primer: GACCATTGACACCTCGACCT. Internal left primer: TGCCAGAAGCATTGTACGAG. Internal right primer: GGATGGGTTAACTGGGATGA. Internal WT amplicon: 1933 bp. Deletion size: 931 bp. Deletion left flank: TAGACTGATTATGAGCATGTTTTAAAAAAT. Deletion right flank: TTTTGTTCCAACATTTTTAGTTTAAAATTA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807