Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
JK5500 C. elegans sygl-1(q828) I; qSi150 II. Show Description
qSi150 [sygl-1p::3X flag::sygl-1::tbb-2 3' UTR + Cbr-unc-119(+)] II. Phenotypically gravid, grows as a homozygote. Increased SYGL-1 protein expression, expanded progenitor zone, expanded GSC pool. Reference: Shin H. et al. PLoS Genet. 2017 Dec 12;13(12):e1007121.
JK5535 C. elegans glp-1(q46) III; qSi246 IV. Show Description
qSi246 [glp-1::sfGFP + Cbr-unc-119(+)] IV. Mos insertion of sfGFP tagged GLP-1 in glp-1(0) background. qSi246 rescues glp-1(q46) sterile phenotype. Animals are fertile, superficially wild-type with GFP+ distal germ-lines. Reference: Sorensen EB, et al. A toolkit of tagged glp-1 alleles reveals strong glp-1 expression in the germline, embryo, and spermatheca. microPublication Biology, 2020(06). http://doi.org/10.17912/micropub.biology.000271
JK6690 C. elegans qSi422 [*rajSi50] II. Show Description
qSi422 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site. GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
JK6691 C. elegans qSi423 II. Show Description
qSi423 [gld-1p::GFP::H2B::gld-1 3'UTR(FBEa TGT to ACA & FBEa* TGT to ACA)[*rajSi50] + Cbr-unc-119(+)] II. Modification of gld-1 FBEa and FBEa* in gld-1 3'UTR of single-copy insertion transgene.  Qiu et al., in preparation.
JK6692 C. elegans qSi424 [*rajSi50] II. Show Description
qSi424 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter and GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
JK6693 C. elegans qSi425 [*rajSi50] II. Show Description
qSi425 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. qSi425 contains engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site, and TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter. GFP is visible in germline nuclei. Derived by targeted modification of FBEb in parental strain JK6690. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in FBEa mutant, no product in wild-type). Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
JK6694 C. elegans rajSi50 II; unc-119(ed3) III. Show Description
rajSi50 [gld-1p::GFP::H2B::gld-1 3'UTR + Cbr-unc-119(+)] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. GFP is visible in germline nuclei, low in distal germ cells, increases proximally, strong in oocytes. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa: slc314 GTCACCAAGTACACTTCCAGCAAG / slc311 TGGCAACATGATGTATGGCACA (100 bp band in FBEa wt). FBEb: slc314 GTCACCAAGTACACTTCCAGCAAG / slc304 GGGTTAGCGTTAAGATAACACA (~500 bp band in FBEb wt). References: Theil K, et al. Nature Commun. 2019 Sep 16;10(1):4205. doi: 10.1038/s41467-019-12050-7. PMID: 31527589. Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."
JTL611 C. elegans hsf-1(ljt3[hsf-1::AID*::gfp]) I; ieSi57 II; unc-119(ed3) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Endogenous hsf-1 tagged with the auxin-inducible-degron (AID*) and GFP allows depletion of endogenous HSF-1 in the somatic tissues upon auxin treatment. Animals treated with 1mM of auxin when eggs are laid will arrest in L1 or L2 stage. Reference: Edwards SL, et al. Cell Rep. 2021 Aug 31;36(9):109623. PMID2021 Aug 31;36(9):109623. PMID: 34469721
KAE10 C. elegans seaSi40 I; unc-119(ed3) III. Show Description
seaSi40 [(pCFJ448) (eft-3p::fmo-2 + H2B::GFP) + Cbr-unc-119(+)] I. Higher level of FMO-2 over-expression compared to KAE9. Improved healthspan, stress resistance and longevity. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8.
KAE12 C. elegans seaSi182 II; unc-119(ed3) III. Show Description
seaSi182 [(pCFJ150) (vha-6p::fmo-2 + H2B::GFP) + Cbr-unc-119(+)] II. Over-expression of FMO-2 in the intestine. Long-lived. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8.
KAE9 C. elegans seaSi39 I; unc-119(ed3) III. Show Description
seaSi39 [(pCFJ448) (eft-3p::fmo-2 + H2B::GFP) + Cbr-unc-119(+)] I. Lower level of FMO-2 over-expression compared to KAE10. Improved healthspan, stress resistance and longevity. Reference: Leiser SF, et al. Science 350.6266 (2015): 1375-8.
KRY85 C. elegans ieSi57 II; nhr-25(kry59[nhr-25::AID*::TEV::3xFLAG]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Strain allows somatic depletion of NHR-25::AID*::TEV::3xFLAG using the auxin-inducible degron system. Derived by crossing parental strains KRY84 and CA1200. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.
KRY88 C. elegans nhr-23(kry61[nhr-23::AID*::TEV::3xFLAG]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Strain for somatic depletion of NHR-23::AID*::TEV::3xFLAG using the auxin-inducible degron system. Derived by crossing parental strains KRY87 and CA1200. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.
LWA1031 C. elegans wleSi1852 I; wleSi1565 X. Show Description
wleSi1852 [unc-54p::luciferaseTAG185 + Cbr-unc-119(+)] I. wlels1565 [unc-54p::DanRS_rpr-1::tRNA(CUA)Leu + myo-2p::GFP] X. It is likely that unc-119(ed3) remains in the background. Animals are slightly sick. All animals should express GFP in their pharynx. Expression of the luciferase reporter is dependent upon temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
LWA1560 C. elegans wleSi151 II. Show Description
wleSi151 [unc54p::mCherryTAG156 + Cbr-unc-119(+)] II. It is likely that unc-119(ed3) remains in the background. Superficially wild-type. Expression of the mCherry reporter is dependent upon temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
LWA1564 C. elegans wleSi151 II; wleEx35. Show Description
wleSi151 [unc54p::mCherryTAG156 + Cbr-unc-119(+)] II. wleEx35 [unc-54p::DanRS_rpr-1::tRNA(CUA)Tyr + myo-2p::GFP]. Pick animals expressing GFP in their pharynx to maintain wleEx35. It is likely that unc-119(ed3) remains in the background. Superficially wild-type. Expression of the mCherry reporter is dependent upon expression of temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
LWA1580 C. elegans wleSi1580 I. Show Description
wleSi1580 [unc-54p::JFF_luciferase + Cbr-unc-119(+)] I. It is likely that unc-119(ed3) remains in the background. Superficially wild-type. Expression of the Japanese firefly luciferase reporter can be detected using standard luciferase assays. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
LWA1582 C. elegans wleSi1582 I. Show Description
wleSi1582 [unc-54p::JFF_luciferaseTAG185 + Cbr-unc-119(+)] I. It is likely that unc-119(ed3) remains in the background. Superficially wild-type. Expression of the luciferase reporter is dependent upon temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Expression of the Japanese firefly luciferase reporter can be detected using standard luciferase assays. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
LWA1852 C. elegans wleSi1852 I; wleSi1853 X. Show Description
wleSi1852 [unc-54p::luciferaseTAG185 + Cbr-unc-119(+)] I. wlels1853 [unc-54p::OmeRS_rpr-1::tRNA(CUA)Tyr + myo-2p::GFP] X. It is likely that unc-119(ed3) remains in the background. Animals are slightly sick. All animals should express GFP in their pharynx. Expression of the luciferase reporter is dependent upon temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
MBA227 C. elegans wIs51 V; icbSi2. Show Description
wIs51 [SCMp::GFP + unc-119(+)]. icbSi2 [dpy-7p::mCherry::H2B::unc-54 + Cbr-unc-119(+)]. Seam cell nuclei labelled with GFP. hyp7 nuclei labelled with mCherry. Reference: Hintze M, et al. Genetics. 2020 Apr;214(4):927-939. doi: 10.1534/genetics.119.302896. PMID: 31988193.
MCJ387 C. elegans ieSi57 II; dcr-1(zen79[dcr-1::AID*::3xFLAG]) III; ieSi38 IV. Show Description
AID* degron and 3xFLAG tag inserted at C-terminus of endogenous dcr-1 locus. ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. eSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgenes express modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma, germ line and early embryos. sgRNA #1: CCTCTTCACTTTCTGTGATATGC. Reference: Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. doi: 10.1101/gad.352481.124. PMID: 40659526.
MCJ666 C. elegans ieSi57 II; rpc-1(cdb434[rpc-1::3xFLAG::AID*]) ieSi38 IV. Show Description
3xFLAG tag and AID* degron inserted at C-terminus of endogenous rpc-1 locus. ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. eSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgenes express modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma, germ line and early embryos. Made by CRISPR modification of parental strain MLC1040. sgRNA #1: CGGCGAATTCTGTTTAAGAA; sgRNA #2: GCTACCATAGGCACCACGAG. sgRNA #2 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. doi: 10.1101/gad.352481.124. PMID: 40659526.
MCJ677 C. elegans nsun-2(cdb460[nsun-2::3xFLAG::AID*]) I; ieSi57 II; ieSi38 IV. Show Description
3xFLAG tag and AID* degron inserted at C-terminus of endogenous nsun-2 locus. ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. eSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgenes express modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma, germ line and early embryos. Made by CRISPR modification of parental strain MLC1040. sgRNA #1: TCCAGAATCTGCTGAAACTC; sgRNA #2: GCTACCATAGGCACCACGAG. sgRNA #2 (dpy-10) was used for co-CRISPR to mark jackpot founder plates. Reference: Sakhawala R, et al. Genes Dev. 2025 Oct 1;39(19-20):1198-1218. doi: 10.1101/gad.352481.124. PMID: 40659526.
MD4195 C. elegans unc-119(ed3) III; bcSi69 IV. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. [NOTE: MD4195 can be maintained at 20C instead of 15C because it does not carry an array with guide RNAs targeting essential genes.] Generated in parental strain EG8081. Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4571 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1367. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1367 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1367 array contains a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4572 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1368. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1368 [U6p::rrn-1(sgRNAs1-4 targeting the rrn-1 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1368 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MD4574 C. elegans unc-119(ed3) III; bcSi69 IV; bcEx1370. Show Description
bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1370 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-1 locus) + U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1370 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I) and a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.
MG589 C. elegans xsSi3 II. Show Description
xsSi3 [GFP::utrophin + Cbr-unc-119(+)].  Superficially wild-type.  Carries a germline-expressed actin probe derived from the calponin homology domain of utrophin.  
MG617 C. elegans xsSi5 II. Show Description
xsSi5 [pie-1p::GFP::ani-1(AH+PH)::pie-1 3'UTR + Cbr-unc-119(+)] II. The RhoA biosensor consists of GFP fused to the C-terminal portion of C. elegans anillin, which contain its conserved region (AH) and pleckstrin homology (PH) domain. It lacks the N-terminal myosin- and actin-binding domains but retains its RhoA-binding domain. [NOTE: xsSi5 was originally published as mgSi5.] References: Tse YC, et al. Mol Biol Cell. 2012 Oct;23(20):4020-31.
MG685 C. elegans xsSi43 II; unc-119(ed3) III. Show Description
xsSi43 [cyk-4p::cyk-4::GFP::pie-1 3'UTR + Cbr-unc-119(+)] II. CYK-4::GFP fusion protein expressed in germline and embryo. [NOTE: previously published as mgSi43.] Reference: Zhang D & Glotzer M. Elife. 2015 Aug 7;4.
MG827 C. elegans unc-119(ed3) III; xsSi36 IV. Show Description
xsSi36 [myo-2p::GFP(Y66C)::let-858 3'UTR + Cbr-unc-119(+) IV:13,048,924]. This strain contains a non-fluorescent GFP that can be used to enrich for CRISPR mediated, oligodirected homologous recombination. [NOTE: previously published as mgSi36.]  Reference: Zhang D & Glotzer M. 2014. Efficient site-specific editing of the C. elegans genome. doi: http://dx.doi.org/10.1101/007344.
MH4920 C. elegans unc-119(ed3) III; kuIs102. Show Description
kuIs102 [vgln-1p::vgln-1::GFP + Cbr-unc-119(+)]. Integrated translational VGLN-1::GFP fusion protein. Reference: Zabinsky RA, et al. G3 (Bethesda). 2017 Jun 2. pii: g3.117.043414. doi: 10.1534/g3.117.043414. PMID: 28576776
MH5015 C. elegans kuIs118 II; unc-119(ed3) III. Show Description
kuIs118 [daf-15p::daf-15::mCherry + Cbr-unc-119(+)] II. kuIs118 is a single copy insertion into ttTi5605 via CRISPR/Cas9. Superficially wild-type. mCherry expression observed throughout the body. mCherry detected throughout development by western blot with anti-mCherry antibody, with highest expression levels in early larval stages. Reference: Sewell AK, et al. "The TORC1 phosphoproteome in C. elegans reveals roles in transcription and autophagy” iScience, 20 May 2022, 104186. https://www.sciencedirect.com/science/article/pii/S2589004222004564.
MLC1065 C. elegans pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID*::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous pash-1 tagged with the auxin-inducible-degron (AID*) peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.
MLC1245 C. elegans drsh-1(luc82[myc::AID*::3XFLAG::4xGGSG::drsh-1::4xGGSG::3xFLAG::AID*::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and soma. Animals are superficially wild-type; addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.
MLC1726 C. elegans drsh-1(luc82[myc::AID*::3XFLAG::4xGGSG::drsh-1::4xGGSG::3xFLAG::AID*::myc]) pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID*::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Endogenous pash-1 tagged with the AID* peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germ line. Animals are superficially wild-type, addition of auxin induces embryonic lethality and larval arrest phenotypes. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.
MLC1729 C. elegans drsh-1(luc82[myc::AID*::3XFLAG::4xGGSG::drsh-1::4xGGSG::3xFLAG::AID*::myc]) pash-1(luc71[pash-1::2xGGSG::3xFLAG::AID*::myc]) I; ieSi57 II; unc-119(ed3) III; ieSi38 IV; lucIs20; lucIs24. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Endogenous drsh-1 tagged at both N- and C-termini with the auxin-inducible-degron (AID*) peptide. Endogenous pash-1 tagged with the AID* peptide at the C-terminus. Strain expresses modified Arabidopsis thaliana TIR1 tagged with mRuby in soma and germline. In addition, strain expresses mirtron-versions of mir-35 and mir-51, which are processed independently of Drosha and Pasha. miRNA biogenesis can be stringently inhibited via simultaneous removal of Drosha and Pasha, causing absence of all canonical miRNAs and embryonic lethality upon Auxin treatment. Reference: Dexheimer et al. Curr Biol. 2020 Dec 21;30(24):5058-5065.e5. doi: 10.1016/j.cub.2020.09.066. Epub 2020 Oct 29. PMID: 33125867.
MLC2465 C. elegans oxIs322 II; unc-119(ed3) III; lucEx1311. Show Description
oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. lucEx1311 (myo-3p::R2pH::LAMP1::3xFLAG::unc-54 3’UTR + ttx-3p::mCherry). Pick mCherry+ to maintain. Reference: Gutierrez-Perez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
MLC450 C. elegans lucSi23 II; henn-1(tm4477) III. Show Description
lucSi23 [rab-3p::HEN1::unc-54 3’UTR + Cbr-unc-119(+)] II. Superficially wild-type. Cell-type-specific 3'-terminal 2'-O-methylation of animal miRNAs by a genetically encoded plant-specific methyltransferase (Arabidopsis thaliana HEN1). NOTE: This strain might still carry unc-119(ed3) in the background. Reference: Alberti C, et al. Nat Methods. 2018 Feb 26. doi: 10.1038/nmeth.4610.
MLC528 C. elegans lucSi28 II; henn-1(tm4477) III. Show Description
lucSi28 [myo-2p::HEN1::unc-54 3’UTR + Cbr-unc-119(+)] II. Superficially wild-type. Cell-type-specific 3'-terminal 2'-O-methylation of animal miRNAs by a genetically encoded plant-specific methyltransferase (Arabidopsis thaliana HEN1). NOTE: This strain might still carry unc-119(ed3) in the background. Reference: Alberti C, et al. Nat Methods. 2018 Feb 26. doi: 10.1038/nmeth.4610.
MLC530 C. elegans lucSi30 II; henn-1(tm4477) III. Show Description
lucSi30 [unc-31p::HEN1::unc-54 3’UTR + Cbr-unc-119(+)] II. Superficially wild-type. Cell-type-specific 3'-terminal 2'-O-methylation of animal miRNAs by a genetically encoded plant-specific methyltransferase (Arabidopsis thaliana HEN1). NOTE: This strain might still carry unc-119(ed3) in the background. Reference: Alberti C, et al. Nat Methods. 2018 Feb 26. doi: 10.1038/nmeth.4610.
MLC557 C. elegans lucSi37 II; henn-1(tm4477) III. Show Description
lucSi37 [rps-5p::HEN1::unc-54 3’UTR + Cbr-unc-119(+)] II. Superficially wild-type. Cell-type-specific 3'-terminal 2'-O-methylation of animal miRNAs by a genetically encoded plant-specific methyltransferase (Arabidopsis thaliana HEN1). NOTE: This strain might still carry unc-119(ed3) in the background. Reference: Alberti C, et al. Nat Methods. 2018 Feb 26. doi: 10.1038/nmeth.4610.
MLC559 C. elegans lucSi39 II; henn-1(tm4477) III. Show Description
lucSi39 [elt-2p::HEN1::unc-54 3’UTR + Cbr-unc-119(+)] II. Superficially wild-type. Cell-type-specific 3'-terminal 2'-O-methylation of animal miRNAs by a genetically encoded plant-specific methyltransferase (Arabidopsis thaliana HEN1). NOTE: This strain might still carry unc-119(ed3) in the background. Reference: Alberti C, et al. Nat Methods. 2018 Feb 26. doi: 10.1038/nmeth.4610.
MLC664 C. elegans lucSi40 II; henn-1(tm4477) III. Show Description
lucSi40 [rgef-1p::HEN1::unc-54 3’UTR + Cbr-unc-119(+)] II. Superficially wild-type. Cell-type-specific 3'-terminal 2'-O-methylation of animal miRNAs by a genetically encoded plant-specific methyltransferase (Arabidopsis thaliana HEN1). NOTE: This strain might still carry unc-119(ed3) in the background. Reference: Alberti C, et al. Nat Methods. 2018 Feb 26. doi: 10.1038/nmeth.4610.
MLC749 C.elegans lucSi61 II; henn-1(tm4477) III. Show Description
lucSi61 [ASEp::HEN1::unc-54 3’UTR + Cbr-unc-119(+)] II. Superficially wild-type. Cell-type-specific 3'-terminal 2'-O-methylation of animal miRNAs by a genetically encoded plant-specific methyltransferase (Arabidopsis thaliana HEN1). NOTE: This strain might still carry unc-119(ed3) in the background. Reference: Alberti C, et al. Nat Methods. 2018 Feb 26. doi: 10.1038/nmeth.4610.
MLC900 C. elegans lucSi91 II; henn-1(tm4477) III. Show Description
lucSi91 [myo-3p::HEN1::unc-54 3’UTR + Cbr-unc-119(+)] II. Superficially wild-type. Cell-type-specific 3'-terminal 2'-O-methylation of animal miRNAs by a genetically encoded plant-specific methyltransferase (Arabidopsis thaliana HEN1). NOTE: This strain might still carry unc-119(ed3) in the background. Reference: Alberti C, et al. Nat Methods. 2018 Feb 26. doi: 10.1038/nmeth.4610.
MQD2356 C. elegans hqSi8 II; daf-2(hq363[daf-2::AID*::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi8 [rgef-1p::TIR1::mRuby::unc-54 3'UTR+Cbr-unc-119(+)] II. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi8 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the rgef-1 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the neurons. hqSi8 previously known as hq373. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2374 C. elegans ieSi61 II; daf-2(hq363[daf-2::AID*::mNeonGreen]) unc-119(ed3) III. Show Description
ieSi61 [ges-1p::TIR1::mRuby::unc-54 3' UTR + Cbr-unc-119(+)] II. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the intestine. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.
MQD2375 C. elegans daf-2(hq363[daf-2::AID*::mNeonGreen]) unc-119(ed3) III; ieSi38 IV. Show Description
ieSi38 [sun-1p::TIR1::mRuby::sun-1 3' UTR + Cbr-unc-119(+)] IV. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. A single copy transgene was inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the germ line.
MQD2378 C. elegans hqSi9 II; daf-2(hq363[daf-2::AID*::mNeonGreen]) unc-119(ed3) III. Show Description
hqSi9 [dpy-7p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi9 was generated by replacing the eft-3 promoter of the ieSi57 insertion (oxTi179 site) with the dpy-7 promoter using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the hypodermis. hqSi9 previously known as hq374. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.