| EU552 |
C. elegans |
glp-1(or178) III. Show Description
Temperature sensitive. At 25C: Ste, during embryogenesis. Strong embryonic phenotype (anterior pharynx missing, no morophogenesis) if shifted during adulthood.
|
|
| EU573 |
C. elegans |
orEx2. Show Description
orEx2 [mlc-4p::mlc-4(genomic coding)::GFP::unc-54 3'UTR + rol-6(su1006)]. Maintain by picking Rollers. Rollers are GFP+.
|
|
| EU618 |
C. elegans |
mlc-4(or253)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, DpySteriles and late embryonic or early larval lethals with incomplete elongation/morphogenesis.
|
|
| EU828 |
C. elegans |
dhc-1(or195) I. Show Description
Homozygous or195 hermaphrodites make 100% dead embryos at 26C. One-cell embryo has a very small but bipolar spindle, severe chromosome segregation defect. Maintain at 15C. Previously called spd-4. 2/06: From Bruce Bowerman: The or195 mutation changes base 10,679 of the cosmid clone T21E12 from a C to a T. This corresponds to dhc-1 cDNA nucleotide 9599 (WS153) , which is the center nucleotide of codon 3200. This codon changes from Serine in N2 to Leucine in or195 (S3200L). Note: this is not the same mutation for or195ts that we reported in Hamill et al, 2002(Dev Cell 3, 673-684). The mutation reported in our paper is not present in this strain. We apologize for the confusion. The pairs dhc-11a,b amplify the mutated fragment in dhc-1(or195). The mutation is near the center of this fragment; a clean (gel purified) DNA prep helps get a good read of it. dhc-11b: 5' aacagacgcacgattgacct 3'. dhc-11a: 5' ctcaaatcaaggaaggagct 3'. PCR conditions: 5 min at 94 degrees C; 30 sec at 94 degrees C; 30 sec at 55 degrees C; 1 min at 72 degrees C. 35 Cycles using Taq polymerase.
|
|
| EU918 |
C. elegans |
lon-1(e185) par-3(it71)/qC1 [dpy-19(e1259) glp-1(q339)] III; spn-4(or191) V. Show Description
Temperature sensitive spn-1. Maintain at 15C. Lethal at 25C. Heterozygotes are WT and segregate WT, Lon which give only dead eggs at all temperatures, and Sterile Dpys(ts).
|
|
| EU924 |
C. elegans |
zyg-8(or484) III; lin-2(e1309) X. Show Description
Temperature-sensitive. Maintain at 15C. Reference: Gonczy P, et al. Dev Cell. 2001 Sep;1(3):363-75.
|
|
| EU931 |
C. elegans |
zyg-8(or490) III; lin-2(e1309) X. Show Description
Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C. Viable embryos at permissive temperature of 15C. Mitotic spindle in one-cell stage embryo assembles normally, but microtubules destabilize at anaphase and spindle becomes mis-positioned toward the posterior pole leading to highly abnormal cleavage and chromosome segregation defects. References: Gonczy P, et al. Dev Cell. 2001 Sep;1(3):363-75. Bellanger JM, et al. J Cell Sci. 2007 Aug 15;120(Pt 16):2963-73.
|
|
| EV190 |
C. elegans |
gld-4(ef15) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous nearly sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ef15 homozygotes (pale, nearly sterile, lays few eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schmid M, et al. Genes Dev. 2009 Apr 1;23(7):824-36.
|
|
| EV343 |
C. elegans |
unc-119(ed3); efEx12. Show Description
efEx12 [glp-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Pick non-Unc to maintain. GFP expression in the proliferative region of the germ line (resembling endogenous GLP-1 protein localization), and also in spermatheca and other somatic tissues. Derived by bombarding strain DP38 with LAP-tagged glp-1 fosmid (WRM0630DF02).
|
|
| EV484 |
C. elegans |
efIs155 II. Show Description
efIs155 [mex-5p::rpl-4::FLAG::tbb-2 3?UTR + Cbr-unc-119(+)] II. Tagged RPL-4 can be used for ribosome purifications from germ cells. Reference: Nousch M, et al. G3 (Bethesda). 2020 Sep 3:g3.401644.2020. doi: 10.1534/g3.120.401644
|
|
| EV57 |
C. elegans |
gls-1(ef8) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous nearly sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ef8 homozygotes (nearly sterile, lays few eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Rybarska A, et al. PLoS Genet. 2009 May;5(5):e1000494.
|
|
| EW15 |
C. elegans |
bar-1(ga80) X. Show Description
[NOTE: (10/22/2020) This strain also carries a (T to A) missense mutation in pry-1 which results in a PRY-1 N354K amino acid substitution.] bar-1(ga80) hermaphrodites are usually Egl and often have a protruding vulva (Pvl), although approx. 40% of animals appear WT on plates. Also slightly Unc. In bar-1(ga80) hermaphrodites any of the six vulval precursor cells (P3.p - P8.p) can sometimes fuse with hyp7 without dividing, and P5.p - P7.p can adopt the tertiary cell fate instead of the primary or secondary fates. In addition, the neuroblast QL and its progeny migrate towards the anterior instead of the posterior, and the cell P12 usually adopts the fate of P11. bar-1(ga80) do mate, but poorly. bar-1 encodes a beta-catenin molecule and the ga80 mutation is predicted to cause an early truncation of the protein.
|
|
| EW45 |
C. elegans |
smg-1(e1228) I; unc-30(e191) IV; deIs1. Show Description
deIs1[unc-30(+) + lin-39TL::GFP (yeast DNA)]. A translational fusion of GFP to the C terminus of LIN-39. Present on a YAC. Yeast chromosomal DNA was injected and integrated. Expression is very faint.
|
|
| EW49 |
C. elegans |
unc-30(e191) IV; deIs12. Show Description
deIs12[bar1p::GFP + pSC11(unc-30(+))]. Green worms that are non-Unc.
|
|
| EW51 |
C. elegans |
pvl-5(de4) II. Show Description
de4 is a weaker allele of pvl-5. Weakly penetrant Egl and Pvl phenotype. Low penetrance embryonic lethal and gonad migration defects. pvl-5(de4) animals have fewer Pn.p cells in the ventral midline at mid-L2 larval stage.
|
|
| EW55 |
C. elegans |
dpy-20(e1362) IV; deEx100. Show Description
deEx100 [ajm-1::GFP + HinfI digested complex DNA + lin-44p::4xNLS::GFP + dpy20(+)]. Pick non-Dpy to maintain.
|
|
| EW56 |
C. elegans |
dpy-20(e1362) IV; deEx101. Show Description
deEx101[dpy20(+); ajm-1::GFP; HinfI digested complex DNA; cwn-1p::4xNLSGFP]. Pick non-Dpy to maintain.
|
|
| EW57 |
C. elegans |
dpy-20(e1362) IV; deEx102. Show Description
deEx102[dpy20(+); ajm-1::GFP; HinfI digested complex DNA; egl-20p::4xNLSGFP]. Pick non-Dpy to maintain.
|
|
| EW58 |
C. elegans |
dpy-20(e1362) IV; deEx103. Show Description
deEx103[dpy20(+); ajm-1::GFP; HinfI digested complex DNA; cwn-2p::4xNLSGFP]. Pick non-Dpy to maintain.
|
|
| EW59 |
C. elegans |
dpy-20(e1362) IV; deEx104. Show Description
deEx104 [ajm-1::GFP + mom-2p::4xNLS::GFP + dpy20(+) + HinfI digested complex DNA]. Pick non-Dpy to maintain.
|
|
| EW61 |
C. elegans |
dpy-20(e1282) IV; him-5(e1490) V; deIs4. Show Description
deIs4 [ajm-1::GFP + GFP::lin-39(YAC) + dpy-20(+)]. A transcriptional fusion of GFP to the ATG of lin-39, with a stop codon between GFP and LIN-39 sequences. Present on a YAC. Yeast chromosomal DNA was injected and integrated. Expression is very faint and may get fainter over time. Freeze upon receipt.
|
|
| EW62 |
C. elegans |
smg-1(e1228) I; dpy-20(e1282) IV; him-5(e1490) V; deIs4. Show Description
deIs4 [ajm-1::GFP + GFP::lin-39(YAC) + dpy-20(+)]. A transcriptional fusion of GFP to the ATG of lin-39, with a stop codon between GFP and LIN-39 sequences. Present on a YAC. Yeast chromosomal DNA was injected and integrated. Expression is very faint and may get fainter over time. Therefore, freeze upon receipt.
|
|
| EW75 |
C. elegans |
cwn-2(ok895) IV/nT1 [qIs51] (IV;V); dpy-11(e1180) mom-2(or42) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. Segregate more WT and GFP+, Dpys, and dead eggs. Dpys give only embryonic lethals.
|
|
| EW79 |
C. elegans |
cwn-1(ok546) II; egl-20(n585) IV/nT1 [qIs51] (IV;V); dpy-11(e1180) mom-2(or42) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. Segregate more WT and GFP+, Dpys, and dead eggs. Dpys give only embryonic lethals.
|
|
| FAS32 |
C. elegans |
his-74(uge16[gfp::his-74]) V. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
|
|
| FAS34 |
C. elegans |
his-74(uge18) V. Show Description
Superficially wild-type. Null mutation: premature STOP codon and frame shift. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
|
|
| FAS46 |
C. elegans |
his-72 (uge30[gfp::his-72]) III. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
|
|
| FAS47 |
C. elegans |
his-70(uge31[gfp::his-70]) III. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
|
|
| FAS84 |
C. elegans |
his-71(uge45[gfp::his-71]) X. Show Description
Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
|
|
| FC121 |
C. elegans |
zzIs16. Show Description
zzIs16 [(pJE3) eff-1p::GFP + rol-6(su1006)]. GFP+ Rollers. Chromosomal insertion of zzEx10. Integration site of zzIs16 not yet mapped, but it is not tightly linked to eff-1 II, unc-119 III, or jcIs1 IV. pJE3 has 7.5 kb of eff-1 upstream sequence inserted into pPD95.75, driving cytoplasmic GFP expression.
|
|
| FC183 |
C. elegans |
zzIs22. Show Description
zzIs22 [(pJdC41) (eff-1::GFP) + rol-6(su1006)]. Rollers. All worms have tail whips.
|
|
| FC50 |
C. elegans |
zzEx10. Show Description
zzEx10 [(pJE3) eff-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. eff-1p expression is observed in epithelia committed to fusion and in fused syncytia.
|
|
| FDU1056 |
C. elegans |
mig-17(shc19[mig-17::mNG +LoxP]) V. Show Description
C-terminus of endogenous mig-17 locus tagged with mNeonGreen using CRISPR/Cas9. Reference: Fan J, et al. Elife. 2020 Apr 7;9:e55890. PMID: 32255430
|
|
| FF275 |
C. elegans |
dpy-17(e164) unc-32(f123) ncl-1(e1865)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles (qC1 homozygotes), and embryonic lethals (f123 homozygotes)
|
|
| FF276 |
C. elegans |
dpy-17(e164) unc-32(f121) ncl-1(e1865)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles (qC1 homozygotes), and larval lethals (f121 homozygotes). g to a transition in exon 6 (2874), changing a Gly in Glu in ZK637.8 gene encoding a V-ATPase alpha subunit
|
|
| FG58 |
C. elegans |
dop-4(tm1392) X. Show Description
|
|
| FGP1 |
C. elegans |
unc-119(ed3) III; fgpIs20. Show Description
fgpIs20 [(pFGP79) pie-1p::mCherry::smo-1(GG) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal from fgpIs20. Allows SUMO localization/conjugation to be observed within the germline and embryos. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.
|
|
| FGP2 |
C. elegans |
unc-119(ed3) III; fgpIs21. Show Description
fgpIs21 [(pFGP80) pie-1p::mCherry::smo-1(GA) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal. May be used to follow unconjugated SUMO localization within the germline and embryo. When compared with strain FGP1, the difference in fluorescence signal corresponds to SUMO conjugation in FGP1. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.
|
|
| FGP29 |
C. elegans |
gei-17(fgp1[GFP::FLAG::AID*::loxP::gei-17]) I; ieSi38 IV. Show Description
gei-17(fgp1[GFP::FLAG::AID*::loxP::gei-17]) I. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.
|
|
| FGP3 |
C. elegans |
unc-119(ed3) III; fgpIs23. Show Description
fgpIs23 [(pFGP78) pie-1p::GFP::TEV-S-Tag::smo-1(GG) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal. Allows SUMO localization/conjugation to be observed within the germline and embryos. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.
|
|
| FGP30 |
C. elegans |
gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I; ltIs37 IV. Show Description
gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.
|
|
| FGP4 |
C. elegans |
unc-119(ed3) III; fgpIs24. Show Description
fgpIs24 [(pFGP77) pie-1p::GFP::TEV-S-Tag::smo-1(GA) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal. When compared with strain FGP3, the difference in fluorescence signal corresponds to SUMO conjugation in FGP3. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.
|
|
| FGP7 |
C. elegans |
unc-119(ed3) III; ruIs57; fgpIs20. Show Description
ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Expression of GFP::tubulin fusion in germline and early embryos. fgpIs20 [(pFGP79) pie-1p::mCherry::smo-1(GG) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal from fgpIs20. Allows SUMO localization/conjugation to be observed within the germline and embryos. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.
|
|
| FGP8 |
C. elegans |
unc-119(ed3) ruIs32 III; fgpIs20. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Expression of GFP::H2B histone fusion in germline. fgpIs20 [(pFGP79) pie-1p::mCherry::smo-1(GG) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal from fgpIs20. Allows SUMO localization/conjugation to be observed within the germline and embryos. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.
|
|
| FJ1519 |
C. elegans |
cdk-5(gm336) III. Show Description
cdk-5(gm336) mutants exhibit defects in polarized trafficking of dense-core vesicles in motor neurons, and decreased localization of GLR-1::GFP to puncta in ventral nerve cord interneurons. Note that this strain does not contain GLR-1::GFP. References: Juo P, et al. Mol Biol Cell. 2007 Oct;18(10):3883-93. Goodwin PR, et al. J Neurosci. 2012 Jun 13;32(24):8158-72.
|
|
| FK181 |
C. elegans |
ksIs2. Show Description
ksIs2 [daf-7p::GFP + rol-6(su1006)]. Rollers.
|
|
| FK183 |
C. elegans |
daf-11(ks67) V; ksEx29. Show Description
ksEx29 [daf-7::GFP + lin-44::GFP]. Maintain by picking GFP. daf-7::GFP is dark or invisible. lin-44::GFP is bright in the tail. Grows better at 15C.
|
|
| FK430 |
C. elegans |
lin-15B&lin-15A(n309) X; ksEx30. Show Description
ksEx30 [dyf-3::GFP + lin-15(+)].
|
|
| FN64 |
C. elegans |
fnEx4. Show Description
fnEx4 [unc-85::GFP + rol-6(su1006)]. Rollers. GFP highly expressed in embryos, VPNs in L1, Intestine in L2, VPNs in L3-L4. Maintain by picking GFP+ rollers. Reference: Grigsby IF & Finger FP. (2008) Dev Biol 319(1):100-9.
|
|
| FQ63 |
C. elegans |
lin-15AB(n765) X; wzIs20. Show Description
wzIs20 [lgc-55p::GFP + lin-15(+)]. lgc-55 regulatory sequences drive expression of GFP in neurons, GLR cells and some muscles. Reference: Ringstad N, et al. Science. 2009;325(5936):96-100. doi:10.1126/science.1169243
|
|