Search Strains

WT phenotype.

Animals with the Duplication are WT. Animals which have lost the Duplication are Unc. Throws males.

ssrIs1222 [hlh-11p::hlh-11::GFP]. ssrIs1031 [myo-2p::mCherry]. Translational hlh-11::GFP reporter. Reference: Littlejohn NK, et al. Elife 2020 Oct 20:9:e58815. doi: 10.7554/eLife.58815. PMID: 33078707.

Severely Unc. CRISPR-generated deletion removes 111 bp (ACGATAAGAAAACTA...ATGAATCCGCCCAAG). hrt2 allele is specific to the AO13 unc-44 isoform. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.

CRISPR/Cas9-engineered insertion of GFP tag into the large AO13 splice isoform of the endogenous unc-44 locus at amino acid 6303. Slightly reduced body bends while crawling. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.

hrtSi28 [des-2p::mKate2::maph-1.1 + unc-119(+)] IV. hrtSi28 inserted into cxTi10882. Expression of mKate2::MAPH-1.1 microtubule marker in PVD and FLP. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.

hrtSi41 [des-2p::unc-33L::GFP + unc-119(+)] I. hrtSi41 inserted into ttTi4348. UNC-33L::GFP expression in PVD and FLP. Functional UNC-33::GFP fusion with internal GFP tag inserted at the start of the S isoform. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.

C-terminal GFP tag inserted into endogenous unc-119 locus. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.

hrtSi69 [des-2p::GFP::unc-33s + unc-119(+)] I. hrtSi69 inserted into ttTi4348. GFP::UNC-33S expression in PVD and FLP. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.

hrtEx161 [des-2p::PA-GFP::tba-1 + des-2p::mKate2 + unc-119(+) + myo-2p::mCherry]. Pick mCherry+ animals to maintain array. PA-GFP::TBA-1 expression in PVD and FLP; fluorescence can be induced illumination by blue light. Reference: He L, et al. eLife 2020;9:e55111 doi: 10.7554/eLife.55111.

Unc. ts Dpy.

Maternal effect lethal (Mel) allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP bn115 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schlaitz et al., (2007) Cell 128:115-27.

Maternal effect lethal (Mel) allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP bn115 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schlaitz et al., (2007) Cell 128:115-27.

vaIs33 [unc-2::GFP + lin-15(+)]. Superficially Wild-type.

wyIs813 [unc-86p::GFP::tba-1 + unc-86p:mCherry::PLCdP]. tba-1(ok1135) is a 1036 bp deletion. Strong expression of GFP::TBA-1 signal, low mCherry::PLCdP signal. Reference: Liang X, et al. Elife. 2020 Jul 13:9:e56547. PMID: 32657271.

wyEx9745 [unc-86p::mCherry::PLCdeltaPH + odr-1p::GFP]. Pick GFP+ animals to maintain. zif-1(gk117) is a punitive null allele. mCherry expression in early PVD membrane. Reference: Liang X, et al. Elife. 2020 Jul 13:9:e56547. PMID: 32657271.

wyEx10192 [unc-86p::Cre + lin-32p::mCherry + odr-1p::GFP]. Pick animals with odr-1::GFP expression to maintain array. GFP tag inserted into endogenous gip-2 locus. Low penetrance, multiple gip-2 cluster in soma or dendrite rab-11.1. Reference: Liang X, et al. Elife. 2020 Jul 13:9:e56547. PMID: 32657271.

Heterozygotes are Unc and segregate Unc and non-Unc steriles (oma-1; oma-2 homozygotes). The Oma animal has an empty uterus and lots of oocytes in the gonad arms. Maintain by picking Uncs. zu405 is a gain-of-function mutation which results in temperature sensitive, embryonic lethality. Loss-of-function mutation in either oma-1 or oma-2 alone does not have a detectable phenotype. te33 is a dominant suppressor of the zu405 embryonic lethality. te51 is a mutation that, in the oma-1(zu405te33) background, gives an Oma (Ooctye Maturation defective) phenotype. [NOTE (09/2016; D. Greenstein, unpublished results): The two molecular changes in te33 are different than reported by Detwiler et al. (2001), but nonetheless result in a strong loss of oma-1 function. Sequencing of the original isolate of te33 gave the same result (S. Robertson and R. Lin, unpublished results).] This strain carrying oma-1(zu405te33) contains the following mutations: zu405 [C8889984T; P240L] and te33 [C8889978A, S238stop & C8889863T, H200Y].

non-Unc hermaphrodite strain. yDp14/+; unc-2 males are 60% inviable. yDp14/yDp14; unc-2 males are dead.

non-Unc, somewhat Dpy hermaphrodites. Gives DpyUncs when yDp16 is lost.

oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi13 [par-5p::GFP::par-5::par-5 3' UTR(splice bias) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.2 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi11 [par-5p::par-5::par-5 3' UTR.2(prespliced) + unc-119(+)] II. MOS single copy insertion of PAR-5 under control of the PAR-5 3'UTR.2 isoform exclusively. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

ddIs26 [pie-1p::mCherry::par-6 + unc-119(+)]. oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

oaSi10 [par-5p::GFP::par-5::par-5 3' UTR + unc-119(+)] II. axIs1929 [nmy-2::GFP + mCherry::par-2]. MOS single copy insertion of GFP-tagged par-5 under control of its endogenous regulatory sequences. Reference: Mikl, M. and Cowan, CR. Cell Rep. 2014 Sep 11;8(5):1380-90.

Endogenous lpr-3 locus tagged with ssSfGFP using CRISPR/Cas9. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.

Endogenous let-653 locus tagged with SfGFP using CRISPR/Cas9. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.

Endogenous let-4 locus tagged with mCherry using CRISPR/Cas9. mCherry expression is faint. Superficially wild-type. Reference: Cohen JD, et al. Elife. 2020 Sep 25;9:e57874. PMID: 32975517.

Y54E5A.2. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2070 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGTTTCGGTGTTGAGAGCGT. External right primer: TGGTGCATGATTTGTGGATT. Internal left primer: GCTCACAACTTCACGCAGAG. Internal right primer: TAAACACCAAGTGGCACCAA. Internal WT amplicon: 2168 bp. Deletion size: 1739 bp. Deletion left flank: AATTTCACGGGGTATATTTAATTTTTAATT. Deletion right flank: TTTTATCATGATATCTCAAAAGTTGAGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54E5B.4. External left primer: AAGTTGTCGGAATTGGTTGG. External right primer: TTGCGATTCGAAGAGAGCTT. Internal left primer: CATTGTTCAATATGCACCCAA. Internal right primer: TGGCCACAAAGAAGAAAAGG. Internal WT amplicon: 1138 bp. Deletion size: 684 bp. Deletion left flank: AATTGATGACGCTATTTATGTGAGAACGTG. Deletion right flank: AACGGCACACTGCCGGAATTAAAATTTCCG. Insertion Sequence: TGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54E5A.5, T08B1.6. The allele gk1159 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TGAAGACGTTGAAGCAGGTG. External right primer: TGTTGACGATGACGGTGTTT. Internal left primer: GTGTTGTTGAAGCAGCTGGA. Internal right primer: GTGGAGACGAAGATCCCAAA. Internal WT amplicon: 2024 bp. Deletion size: 775 bp. Deletion left flank: GGGCTAAAAACGCAAAAACTGCAATTTCTA. Deletion right flank: AAAACAAACAATTTTTCAATATAATTTAAC. The allele gk3030 was identified by CGH but not confirmed by PCR. Left flanking probe: CAAAAGAATCAATCCACTAACAAATTGATTGGAATCGCTGGAATTCACTC. Right flanking probe: GCGGGTTTGACCTGACTACAGTACCACTTTATCATCAATCGAAATTGGAG. Left deleted probe: GGAATCGCTGGAATTCACTCGAGAAAATATATGCACACGATGCATGGAAT. Right deleted probe: GCGGGTTTGACCTGACTACAGTACCACTTTATCATCAATCGAAATTGGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Morphological markers unc-5 and dpy-11 balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested nT1 aneuploid progeny, and GFP- unc-5; dpy-11 homozygotes. nT1[qIs51] homozygotes inviable. Pick GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54E5A.4. mIs13 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] I. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim pharyngeal GFP signal, and segregate dim GFP, brighter GFP (mIs13 homozygotes) and GFP- ok617 homozygotes (slow-growing, mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ajIs1 [rCesC05A9.1::GFP + dpy-5(+)] X. GFP expression driven by 300bp sequence upstream of pgp-5 gene. Weak intestinal fluorescence is visible under normal conditions. Derived by insertion of sEx864 in parental strain BC10030. Pathogens, heavy metals, and toxins (e.g. Pseudomonas aeruginosa, cadmium, G418) further induce GFP expression. dpy-5(e907) was likely removed by outcrossing, but might still be in the background. Reference: McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525); WBPaper00031023; WBPaper00048491.

pgIR1 (I, CB4856>N2). CB4856 Chromosome I in N2 background.

Maintain at 15C. Produces dead eggs at 25C.

Unc. Maintain at 15C. Produces dead eggs at 25C.

Heterozygotes are WT with pharyngeal GFP signal, and segragate WT GFP+, arrested hT2 aneuploids, and non-GFP Dpy Unc homozygotes. Homozygous hT2[bli-4 let-? qIs48] are inviable.

Heterozygotes are WT and segregate WT, Smalls which produces dead eggs, and Dpy Steriles. Throws males.

neSi101 [sun-1p::TIR1::mRuby::eft-3 3'UTR + Cbr-unc-119(+)] IV. GFP reporter inserted into C-terminus of endogenous oma-1 locus. AID* degron tag (IAA17) inserted into the endogenous oma-2 locus. Reference: Ertekin A, et al. bioRxiv. 2025 May 12:2025.05.09.653132. doi: 10.1101/2025.05.09.653132. PMiD: 40463014.

neSi101 [sun-1p::TIR1::mRuby::eft-3 3'UTR + Cbr-unc-119(+)] IV. GFP reporter inserted into C-terminus of endogenous oma-1 locus. A triple arginine motif upstream of the oma-1 tandem zinc finger domain is mutated to three alanines. AID* degron tag (IAA17) inserted into the endogenous oma-2 locus. When OMA-2 is present, this mutant does not appear to have obvious phenotypes. Auxin-inducible depletion of OMA-2 causes embryonic lethality: animals lay low numbers of nonviable embryos that are often polynucleated and have weak chitin shells. Reference: Ertekin A, et al. bioRxiv. 2025 May 12:2025.05.09.653132. doi: 10.1101/2025.05.09.653132. PMiD: 40463014.

wtEx30 [cuti-1p::cuti-1::GFP + unc-119(+)]. Maintain by picking non-Unc. Reference: Fritz JA & Behm CA. PLoS One. 2009;4(4):e5117.

Heterozygotes are non-Unc and segregate non-Unc, Sterile Unc, and Dpy Unc. n2510 is a strong lin-45 raf allele: 100% of homozygotes are Sterile and Vul (no discernable vulva) or larval lethal.

wpIs98 [itr-1pB::Chrimson::SL2::mCherry + odr-1p::RFP] I. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829.

qxIs750 [hsp-16.2p::nuc-1::pHTomato::unc-54 3'UTR + hsp-16.41p::nuc-1::pHTomato::unc-54 3'UTR + odr-1p::GFP]. Heat-shock inducible pHTomato transgene for monitoring lysosomal activity. Reference: Sun Y, et al. Elife. 2020 Jun 2:9:e55745. doi: 10.7554/eLife.55745. PMID: 32482227.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2421 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. ok2421 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3294 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. ok3294 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP tm2868 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. tm2868 homozygotes are morphologically wild-type but show ~30% reduction in fertilized eggs and a trans-generational increase in sterility. Maintain under normal conditions. Reference: Bickel JS, et al. PLoS Genet. 2010 Jul 22;6(7):e1001028.