| VC2172 |
C. elegans |
C07G1.2(ok2531) IV. Show Description
C07G1.2. External left primer: TCGTGGCAATTGACTGTGAT. External right primer: CGCCGAATATGATGATGATG. Internal left primer: TTTTTGTGAATCTGGAAGAGAATG. Internal right primer: TTACTCACCCAAATCCGAGC. Internal WT amplicon: 1139 bp. Deletion size: 346 bp. Deletion left flank: TTATCCCAATGTTACATTCCACCATGTCCA. Deletion right flank: CTTCTGCTCTAACTAGCTATTTCTATTTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2175 |
C. elegans |
klo-1(ok2925) IV. Show Description
C50F7.10. External left primer: TCCGATCGACAGCTAACCTT. External right primer: AAAGGATCCAGTTTGCCTCA. Internal left primer: TTTCTCTCATTGAGGCTGGG. Internal right primer: TCATTCCGTCGATGTCTTGT. Internal WT amplicon: 1104 bp. Deletion size: 592 bp. Deletion left flank: GCCTGCATGTTTATTTCGTTGAAAGTTATC. Deletion right flank: AAAGACATAACCGAACAAGACATCGACGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2181 |
C. elegans |
C54E4.2(gk1083) IV; alh-2(gk3053) V. Show Description
K04F1.15, C54E4.2. The allele gk1083 was identified by PCR, validated by CGH, and can be detected using the following PCR primers. External left primer: TTTTTGACGACCAACCAACA. External right primer: CGAGGCTCTTTACGCAATTC. Internal left primer: CGCAGCGAACAAAGTTATGA. Internal right primer: CGTGGCGAGACCTATAAAGC. Internal WT amplicon: 1288 bp. Deletion size: 575 bp. Deletion left flank: TGAATACCGTTAATTTTTTTTTTTTAATTA. Deletion right flank: TTCGCTGAAAAATATAATTTCTTTCTGGTG. The allele gk3053 was identified by CGH and not confirmed by PCR. Left flanking probe: ATTTTACATTAGTCCGTGAATTTCAGATACTACGCCGGATATGCTGATAA. Right flanking probe: GCGCGGGATCAGTTTGGGTCAACTGTTATGATGTTTTTGATCCTGCTGCT. Left deleted probe: TATGCTGATAAAAACCACGGAAAAACCATTCCCGTCGGTGGAGACTATTT. Right deleted probe: TGAATAAAGCTCTTCAAGTCGCAAATACTATCCGCGCGGGATCAGTTTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2182 |
C. elegans |
spe-17(ok2593) IV/nT1 [qIs51] (IV;V). Show Description
ZK617.3. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2593 homozygotes (often sterile or nearly sterile, but population can be maintained). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCTGCACCTAACAATCAGC. External right primer: CAAGCGAACAGCAGTCACAT. Internal left primer: GCTTGAATTTTTGACTGTGGC. Internal right primer: GTTGTCGAATTATTGCGGCT. Internal WT amplicon: 1167 bp. Deletion size: 416 bp. Deletion left flank: AATTATTTCTCACTCTTTGAAATTATCAAG. Deletion right flank: TTAGTATTCTGGATGTTTGAGTGAGTAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2187 |
C. elegans |
ruvb-1(ok2847) V/nT1 [qIs51] (IV;V). Show Description
C27H6.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2847 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTCCACGTCCTCTACCTGA. External right primer: GTCAAGGGACTCGGAATTGA. Internal left primer: TCTTCCACACGTTTGAGCAC. Internal right primer: CTACAGGCTGCTGGATTCGT. Internal WT amplicon: 1221 bp. Deletion size: 780 bp. Deletion left flank: CTCGAGCGCGCGATAGAGATAGGTAAAACA. Deletion right flank: AGCAATCAATACAGCTCGTCCGGCCATACA. Insertion Sequence: ATCAATACAATCAATACAATCAATACATCAATACAATTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2192 |
C. elegans |
lpr-2(ok2915) IV. Show Description
T12A7.5. External left primer: GAAAATATTCGGCCTGCAAA. External right primer: GCACCAGTAGAGAACGGCTC. Internal left primer: CGAGTGCTAACTGTGGTTGC. Internal right primer: GGAATTTGACTGGAAAAGGG. Internal WT amplicon: 1155 bp. Deletion size: 436 bp. Deletion left flank: ATCTATCGAGAACTTCAAAAAGTTTGTGTG. Deletion right flank: TTTTTCAACAAGAATTTATCTTAAACTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2195 |
C. elegans |
C04G2.8(ok2887) IV. Show Description
C04G2.8. External left primer: TGTCCTGGGTAGGTTGGGTA. External right primer: ATCCCGAATCTGTCCAATCA. Internal left primer: GACCTTTTCACGAGGCAATC. Internal right primer: GGTCCTTCGACAACCATAGC. Internal WT amplicon: 1315 bp. Deletion size: 407 bp. Deletion left flank: ATTGAAAACGATTGGATAGAGAAGTCAGCG. Deletion right flank: AATAAGAGCGACTTCTGGAGCGGCTTCTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2196 |
C. elegans |
T12G3.1(ok2892) IV. Show Description
T12G3.1. External left primer: AGGAAGAGTGTGCGCCTTTA. External right primer: AATTCAGCAGAGCTGGCTTC. Internal left primer: TGTCAACGGACCAATCTTTG. Internal right primer: CTTCTTGTTCAAGACGGGCT. Internal WT amplicon: 1199 bp. Deletion size: 795 bp. Deletion left flank: ATCAGTGAGCACTGAAACTGCCAAAAAAGC. Deletion right flank: AATGACCAAATTCGAAGAGAAAATGGATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC220 |
C. elegans |
cmk-1(ok287) IV; gkDf56 Y102A5C.36(gk3558) V. Show Description
This strain is homozygous for a deletion (ok287) in K07A9.2, detectable by PCR using the following primers. External left primer: CAGTGCCTTTAGGGCTTGAG. External right primer: GGGGTACTGTGGCTGAAAAA. Internal left primer: TAAATCAAACGCCCTTGGAA. Internal right primer: AAACGAAAACCCGGAGAAAT. Internal WT amplicon: 2970 bp. Deletion size: 1921 bp. Deletion left flank: TGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCTAGGATCTGGGGTAGGCCT AGGATCTGGGGTAGGCCTAGGATC. Deletion right flank: GAAATACGGCGTACACACACGATATTCACG. Validation: ok287 passed by CGH. Other deletions (gkDf56 and gk3558) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2206 |
C. elegans |
C33A12(ok2888) IV. Show Description
C33A12. External left primer: CGTTGAGAGCTCCACACAAG. External right primer: GAAATTGAGCACAAAAGGGG. Internal left primer: TGCATAACGGCTTCAGTCAT. Internal right primer: GCTAGCGAGCCTCTTACAGC. Internal WT amplicon: 1141 bp. Deletion size: 344 bp. Deletion left flank: TACCAAATGGGTGCAACTTTGTAATATAAT. Deletion right flank: CTAACTGACATGCCAAAAAATCTGCGCGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2211 |
C. elegans |
pqn-90(gk989) IV. Show Description
Y73F8A.8. External left primer: ACAACCCGTGCAAGAAAAAC. External right primer: AAGTGGGACGGAACTGTTTG. Internal left primer: ACAATCGCGTCAGTAGGAGC. Internal right primer: CAGGGTTGTAGGACGTTGGT. Internal WT amplicon: 1894 bp. Deletion size: 519 bp. Deletion left flank: AAGCTGGTGCAGATGGAAGTGTGCATTGTG. Deletion right flank: AAGATTGACACTCATTCATAGATGGAGCAA. Insertion Sequence: ATTGACACTCATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2212 |
C. elegans |
pqn-90(gk999) IV. Show Description
Y73F8A.8. External left primer: ACAACCCGTGCAAGAAAAAC. External right primer: AAGTGGGACGGAACTGTTTG. Internal left primer: ACAATCGCGTCAGTAGGAGC. Internal right primer: CAGGGTTGTAGGACGTTGGT. Internal WT amplicon: 1894 bp. Deletion size: 544 bp. Deletion left flank: TTGTCTGGCATGGTTGAGTACATTCCTGAT. Deletion right flank: TTGTTGGCATGAACAACTTGGTTGAACTTG. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2213 |
C. elegans |
C54E4.2(gk1003) IV. Show Description
C54E4.2. External left primer: TTTTTGACGACCAACCAACA. External right primer: CGAGGCTCTTTACGCAATTC. Internal left primer: CGCAGCGAACAAAGTTATGA. Internal right primer: CGTGGCGAGACCTATAAAGC. Internal WT amplicon: 1288 bp. Deletion size: 469 bp. Deletion left flank: TTTTTTTTTTTGGAGCTTCAGTTGAAGTTG. Deletion right flank: AGTCTCAGGAATGCAATTATAATTAGATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2215 |
C. elegans |
bed-3(gk996) IV. Show Description
T25H8.6. External left primer: GCTCCTTCACCAACACCATT. External right primer: CGAGTGTTTGAAGTCTGGCA. Internal left primer: CGTGCCGAGACTCATCTACA. Internal right primer: TTCAATTAACTGGGCTTCCG. Internal WT amplicon: 2248 bp. Deletion size: 925 bp. Deletion left flank: GACTTTCGAAGTCTTGAACACCTCACTTTT. Deletion right flank: GAAGCTTCAACTAAAATCTTTCCCCTGTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2239 |
C. elegans |
Y45F10D.10(ok2907) IV. Show Description
Y45F10D.10. External left primer: CGTCTCCACTAGCTCCTTGG. External right primer: GGAGTCCTCCGCAAACATTA. Internal left primer: AGATTTTTCGCTTTCCCTCC. Internal right primer: GCCAGAAACTCGCTTGAACA. Internal WT amplicon: 1318 bp. Deletion size: 546 bp. Deletion left flank: GGCATACGTCGTCAAAAGTATCAGCTCGAT. Deletion right flank: TTTGAATTAGAGAATTTATCTGGAAAATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2246 |
C. elegans |
R13H9.5(ok2966) IV. Show Description
R13H9.5. External left primer: AATGAACTCAAAACGGGACG. External right primer: TGTAATGACGCTTGTCGGAA. Internal left primer: CGGTTCCAGTCCAGTCTGAT. Internal right primer: AGTCTTTGCAGGTAAATACGAGTT. Internal WT amplicon: 1219 bp. Deletion size: 424 bp. Deletion left flank: CGACATTTATAAAACCATTTATTCAAATCA. Deletion right flank: GTTCTAAAGGTCTGAAAATTATCAAATTAC. Insertion Sequence: TTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2250 |
C. elegans |
nstp-3(ok2873) V/nT1 [qIs51] (IV;V). Show Description
ZC250.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2873 homozygotes (late larval arrest or sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTATCCCAAATTCCCTT. External right primer: CGTTTCATTGGGATACCTGG. Internal left primer: TTTTTGCAAATTTCCATCCG. Internal right primer: AATCTTGGCATCCACCTCAC. Internal WT amplicon: 1225 bp. Deletion size: 429 bp. Deletion left flank: TTAATAGGAAGCTGAGAATGTCAATTTTTG. Deletion right flank: AACTGATGAAAAATGGAAGAATTTAGGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2251 |
C. elegans |
C42C1.4(ok2912) IV/nT1 [qIs51] (IV;V). Show Description
C42C1.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2912 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCGCTCGGAGAGTTGTACC. External right primer: ACGTGCTACCGTAATCCGAC. Internal left primer: TCGCACTTACCGTATCCACA. Internal right primer: TGATCCTGAAAAGGGGACAG. Internal WT amplicon: 1205 bp. Deletion size: 429 bp. Deletion left flank: TTTCGAAAGAGAATCCATAGATAGTCGATC. Deletion right flank: TCCTTTAAGAATTGGTGTTGAAAAGACTAG. Insertion Sequence: TCAACAAGCTATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2253 |
C. elegans |
spe-17(ok2631) IV. Show Description
ZK617.3. External left primer: TGCTGCACCTAACAATCAGC. External right primer: CAAGCGAACAGCAGTCACAT. Internal left primer: GCTTGAATTTTTGACTGTGGC. Internal right primer: GTTGTCGAATTATTGCGGCT. Internal WT amplicon: 1167 bp. Deletion size: 557 bp. Deletion left flank: TTAGCTGAAGTATTGGAAAAATCTCAGAAA. Deletion right flank: TGGTTAGTATTCTGGATGTTTGAGTGAGTA. Insertion Sequence: AAAAAAATCAAAAAAATCTCAAAAAAAAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2258 |
C. elegans |
cbd-1(ok2913) IV. Show Description
H02I12.1. External left primer: AAACCAGTAGCCCTCCGTTT. External right primer: TGGATCTTTCCCATTCTTGC. Internal left primer: TGCAGCGATGATTCTGTCTT. Internal right primer: GTCGAGGGATGAAGAATGGA. Internal WT amplicon: 1127 bp. Deletion size: 646 bp. Deletion left flank: ACTACGCCGACGGTTGCAATGACGTATTCT. Deletion right flank: CGTATCTTGAGAATCCATTCTTCATCCCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2260 |
C. elegans |
Y54G2A.20(gk1017) IV. Show Description
Y48G2A.20. External left primer: TCGCAATGAGTGTTCTCCTG. External right primer: CTCATTCCCTGAACTCTCGC. Internal left primer: GGACAGGCCGCATACATATT. Internal right primer: ATCTCAAGAACGTTCACCGC. Internal WT amplicon: 2280 bp. Deletion size: 415 bp. Deletion left flank: TGTCATCCAATAAAACCATTTTGTGAGAGT. Deletion right flank: GGAAATTTCCATCTTCTGATTAGAGGTCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2268 |
C. elegans |
tin-9.1(ok2194) IV. Show Description
C06G3.11. External left primer: ATTCACAGGACACGGAGGTC. External right primer: TCCTGAGAGCACGAAATGTG. Internal left primer: ACGTGGATAAACTTCGCGTC. Internal right primer: CGCAGATAACGATCAAGGAA. Internal WT amplicon: 1786 bp. Deletion size: 983 bp. Deletion left flank: TGCTGTGTTTTGATTTCAAAAACTCAACGC. Deletion right flank: GAAAAATTTAATCTTAAAAATCTCAATTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2274 |
C. elegans |
cky-1(gk1011) V/nT1 [qIs51] (IV;V). Show Description
C15C8.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk1011 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCAACATCACCCAACTGGAA. External right primer: ACATGATGACCCTTTAGCGG. Internal left primer: CATCCTGCAGCTCAAGTGAA. Internal right primer: GCTTACACGCATGCCATAAA. Internal WT amplicon: 1542 bp. Deletion size: 516 bp. Deletion left flank: GAGTTCGGGAGGTAGATGGTCAGGGCGTGA. Deletion right flank: TGATTAGGTTTTGACTATTTAAAAAAGCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2280 |
C. elegans |
dre-1(ok2905) V/nT1 [qIs51] (IV;V). Show Description
K04A8.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2905 homozygotes (early larval arrest; escapers may lay eggs that hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGAAGTAGGGATTCGCATGA. External right primer: CCCCTTTCAATTTCGAGTCA. Internal left primer: CAGCCAAAGTATTTCGAGCA. Internal right primer: CAGAAGGTCGAGGGAGACAT. Internal WT amplicon: 1211 bp. Deletion size: 741 bp. Deletion left flank: CTGCTGCCTGCACACTGGATCAGCCCGAAA. Deletion right flank: TTTTTTTCATTATTTCTTATCTCAAAAATG. Insertion Sequence: TCATTTTTTTATCTATCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2319 |
C. elegans |
ZK185.1(gk3229) IV. Show Description
ZK185.1. Homozygous viable deletion, detectable by nested PCR. External left primer: TCCAAGTCAGCGCCTCTTAT. External right primer: AATTCAGCGAAAATGATCCG. Internal left primer: TTGGCGATGAACGTACCATA. Internal right primer: AATCGTGTAGCTGGTGGAGG. Internal WT amplicon: 1766 bp. Deletion size: 472 bp. Deletion left flank: TTCACAAAAAGTTAGATAAAAAGGTTGTGC. Deletion right flank: CAGCTAGTTTTTGTGCATTTTCTCAGATGT. Insertion sequence at break: GGCTAGTTTTTGTG. Validation: gk3229 confirmed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2321 |
C. elegans |
gcy-18(ok3047) IV/nT1 [qIs51] (IV;V). Show Description
ZK896.8. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3047 homozygotes (sterile, lays eggs that don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATCGCTAATCCACTGGAACG. External right primer: CGATCCTCCAACCAGAATGT. Internal left primer: CTGCAAAAGATTCGGACGAT. Internal right primer: GTGCCCTTTCCTTTCACTTG. Internal WT amplicon: 1263 bp. Deletion size: 517 bp. Deletion left flank: TTTCAGCAATAATCTATATGGCTCCTGAAC. Deletion right flank: GAATGTTAGAAGAAGCCAACATCCGTGCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2323 |
C. elegans |
dct-13(gk992) IV. Show Description
Y116A8C.17. External left primer: AGCGAGCATTGCAAAAAGAT. External right primer: TATGAATGTCCGTGCTCTGC. Internal left primer: AAGAGCTGAGCAATGCCAAT. Internal right primer: ACAGCGTTTGTTCCGTATCC. Internal WT amplicon: 785 bp. Deletion size: 94 bp. Deletion left flank: AATTGACACCTGGCTCCGTACTTGCAATAT. Deletion right flank: ATTTGCATGCTTCACCGTAAATGCATGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2329 |
C. elegans |
frm-1(gk1084) I; cTe154X.1(gk3193) III; gkDf29 IV. Show Description
This strain is homozygous for a deletion (gk1084) in ZK270.2, detectable by PCR using the following primers. External left primer: AATGGTGACACGATGCTCAA. External right primer: ACACAGACACAGCAAGACGG. Internal left primer: GTTAAATTCCAGTGGCTGCG. Internal right primer: GAAGCCGATGGACAAAGAGA. Internal WT amplicon: 796 bp. Deletion size: 179 bp. Deletion left flank: ATAATTTGCTAGTCTTTTTGGAATTTTTCT. Deletion right flank: GATTTAGGTATTTTAAAGTCGACGGACAAA. Validation: gk1084 passed by diagnostic PCR. No CGH probes for gk1084. Other deletions (gk3193, gkDf29) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2337 |
C. elegans |
Y116A8C.4(ok3077) IV. Show Description
Y116A8C.4. External left primer: CGACGTTGTTTCCAGGATTT. External right primer: TTCCACCCAACTCACATTCA. Internal left primer: GCGCTGAGCTCTCAAAGACT. Internal right primer: GACAAGCCCCATAAAGTCCA. Internal WT amplicon: 1215 bp. Deletion size: 526 bp. Deletion left flank: TGTATCACGCTTGCTCATCAATTGGTAGGA. Deletion right flank: TTTCTTCAAATAGTTATTTTAGAAATGCTC. Insertion Sequence: TCGACATCTTCCGGGTTTCCAGACCCATAAAATGTCGGTTGCTAGATAATAAATCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2346 |
C. elegans |
hsp-12.3(ok3095) IV. Show Description
F38E11.1. External left primer: TAAATCGGCAGAAAACGACC. External right primer: TGTTGCTCTCGAATCGTCAC. Internal left primer: AAAATTGTGGCCACCAAAAA. Internal right primer: ATTTCGTTGCTCATTGGTCC. Internal WT amplicon: 1297 bp. Deletion size: 533 bp. Deletion left flank: TGTTCACCATAAGAAACGAGGCGTCTCCTC. Deletion right flank: AAGGAATTCTCCAATGTTCTTCACATCAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2352 |
C. elegans |
R07C12.1(ok3048) IV/nT1 [qIs51] (IV;V). Show Description
R07C12.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3048 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATTTGGAGGCCAGTGTTGT. External right primer: GCCCTGAAACCGAAGTGTAA. Internal left primer: GCTCTGTTTGTAGGCTTGGG. Internal right primer: CAGCATATGGTGGCCAGTAG. Internal WT amplicon: 1301 bp. Deletion size: 537 bp. Deletion left flank: AATTGGTAGTGACTCGTTGAAAATTGTTGA. Deletion right flank: TGGTATACGTTTCTTTAAATTTTTTTTAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2354 |
C. elegans |
T08G11.2(gk3172) I; pqn-90(gk1127) IV; T10B10.3(gk3173) X. Show Description
T10B10.3, T08G11.2, Y63F8A.8. The gk1127 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: ACAACCCGTGCAAGAAAAAC. External right primer: AAGTGGGACGGAACTGTTTG. Internal left primer: ACAATCGCGTCAGTAGGAGC. Internal right primer: CAGGGTTGTAGGACGTTGGT. Internal WT amplicon: 1894 bp. Deletion size: 1379 bp. Deletion left flank: CCGGTTTTTCTACCGCCATATGTCCCCTCC. Deletion right flank: GGTTGAGTTGCTTGTTGGCATGAACAACTT. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2362 |
C. elegans |
unc-22(gk3072) IV. Show Description
Unc-22 twitcher. This strain was isolated after UV/TMP mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk3072), it is homozygous for 65 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
|
|
| VC2365 |
C. elegans |
F11E6.8(gk1178) IV. Show Description
This strain is homozygous for a deletion (gk1178) in F11E6.8, detectable by PCR using the following primers. External left primer: ACATATTCGACAAGGCACCC. External right primer: CACCCTTCGAGTCTACCCAG. Internal left primer: GCGAGTGAAAGGATCTGGAG. Internal right primer: TGGTGAGGGAATTGGAAAGA. Internal WT amplicon: 2406 bp. Deletion size: 1746 bp. Deletion left flank: ATTTTCCCATTTAGGTATACAAAACTTACA. Deletion right flank: GAGGCAAACTTCTCACTTCTTGAAACATTT. Validation: gk1178 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2366 |
C. elegans |
unc-22(gk1237gk1238) IV. Show Description
Unc-22 twitcher. The gk1237 lesion is a point mutation (C to A) with flanks TTCCATATGGATTGGACACCTCGACTGTGT and CTCTCCAGCATCAATGTCCCAAACTTCCTT. The gk1238 lesion is a 122-bp deletion with flanks CTCCATCACTTGCTTCGAATCTATATCTGC and ACGATTTGTGGGCGACTTCCACCGGATTCC, and a single inserted base (C) at the break. Primers to amplify the region are: cggatgcttggaacaaagtt and tgctcgtgtcactggacttc. This strain was isolated after UV/TMP mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk1237gk1238), it is homozygous for 90 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
|
|
| VC2371 |
C. elegans |
W03B1.2(gk3214) dct-15(gk3215) IV; C47E8.6(gk1082) V; F53H4.5(gk3216) X. Show Description
This strain is homozygous for a deletion (gk1082) in C47E8.6, detectable by PCR using the following primers. External left primer: CCGTTACCATGCCAACTCTT. External right primer: TGATTTTGGCCGAGTAGGAC. Internal left primer: CCGTCACCTCTTAACGGAAA. Internal right primer: CGAACCAACCAGAATCTTCG. Internal WT amplicon: 1333 bp. Deletion size: 468 bp. Deletion left flank: GACCAATGCAGCTTCCCGTCGAAAACCTGC. Deletion right flank: GAATATCTTAAGACAATCTGATGATCTTCT. Validation: gk1082 passed by diagnostic PCR, CGH. Other deletions (gk3214, gk3215, gk3216) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2374 |
C. elegans |
nol-10(ok2965) IV/nT1 [qIs51] (IV;V). Show Description
F32E10.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2965 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGAGACATGGCACTTTCAGA. External right primer: TCCAAATCCGAAGCCATATC. Internal left primer: GGATGTTGGCTGACTCCATT. Internal right primer: CAGAGTCGGATGCATCATTG. Internal WT amplicon: 1188 bp. Deletion size: 334 bp. Deletion left flank: TGTCGTTGCTTCTATGGATTCTAGAATGAT. Deletion right flank: CTATACAACAAAGCTCAAACACAAATGCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2375 |
C. elegans |
gcy-25(gk1187) IV. Show Description
Y105C5B.2. Identified by PCR, validated by CGH. External left primer: GCCGCAATTGTATTCTCCAT. External right primer: AATTCCCTGTTCACAGCGTC. Internal left primer: TATGTAGGGAATCGCGAAGG. Internal right primer: CTCTTGCTTCGAAACCCAAT. Internal WT amplicon: 2288 bp. Deletion size: 1832 bp. Deletion left flank: TCGATTTTTTCGGGAAATGTTGCGGAGCAC. Deletion right flank: ATTCTCAAAATTAGCTCTTTCAGTTCGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2379 |
C. elegans |
T05E11.3(ok1964) IV/nT1 [qIs51] (IV;V). Show Description
T05E11.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1964 homozygotes (scrawny larval arrest or grotty sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCCGAAGATGAAATCGAAGA. External right primer: ACAGATGATGATCGGGAAGC. Internal left primer: GCACCAAAGGAAACCAAAGA. Internal right primer: GTTGTTTCTTCAGCGGCTTC. Internal WT amplicon: 3156 bp. Deletion size: 1613 bp. Deletion left flank: AGATTTTCCTCCGTGAGCTTATTTCTAATG. Deletion right flank: GTCTTGAAGAGGAGTTCAAGCCACTTACTG. Insertion Sequence: GCCAAGGAAGCCCACAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC239 |
C. elegans |
sams-5(gk147) IV. Show Description
T13A10.11a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2392 |
C. elegans |
elks-1(ok2762) IV. Show Description
F42A6.9. External left primer: TCTCAGCTCATCGGTACCCT. External right primer: CCTTATGGTTAGGGCCACCT. Internal left primer: CATAACTCGGCTCCCTGCTA. Internal right primer: GGCCTAGGAATCTCTTACACAGTC. Internal WT amplicon: 1124 bp. Deletion size: 702 bp. Deletion left flank: GTTCTCAATGGTCGCCTTCAACTGTGTCAT. Deletion right flank: GTTTTCGATAGCTTGCCGGCCTGATGGATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2394 |
C. elegans |
pqn-90(gk1086) IV. Show Description
Y73F8A.8. External left primer: ACAACCCGTGCAAGAAAAAC. External right primer: AAGTGGGACGGAACTGTTTG. Internal left primer: ACAATCGCGTCAGTAGGAGC. Internal right primer: CAGGGTTGTAGGACGTTGGT. Internal WT amplicon: 1894 bp. Deletion size: 519 bp. Deletion left flank: AACTGAAGGTTCTAGGATGACAGTCACAATTTGTGGAGCAACAACTGGAGATTGGCATG CTGATTGGCATTGCTGACATTGTGGAGCAGCTGGTTGCTGACATTGTGGAATACATTGT TGTTGGCACTGTTGAGTCTGTTGGCACGAAGTTTGACATTGTTGGCAAGCTGGTGCAGA TGGAAGTGTGCATTGTGGAGCACACTGTTGCTGGCAAACTGGAGCATACTGCTGGCAAG TATTCTGGCACTGCTGGCACTGTGGAGCTGATGGCTGTTGGCA. Deletion right flank: CACTTGGTAAGTTACTTGCTGAACTGGTTGGGCACATGAGCAGGATGTCTGGACTGGAG CAGTGTTCTGACACGAACAACTGTACTGTTGTGGTTGAGTTGCTTGTTGGCATGAACAA CTTGGTTGAACTTGTGAAGCACAACCACATGATTGACGTTTATCACGAATTGAA. Validation: No CGH probes for gk1086. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2396 |
C. elegans |
mec-3(gk1126) IV. Show Description
F01D4.6. Identified by PCR, validated by CGH. External left primer: CGCGTTGAAGTCAGTTGTGT. External right primer: GACTCCTGTTGGATTGGCAT. Internal left primer: CTGCCACATCAGTGTTGCTT. Internal right primer: CAAAGCCTCTCAGTGCGATT. Internal WT amplicon: 2450 bp. Deletion size: 774 bp. Deletion left flank: GAGCAAAGCGTAAAAAATGATTACATCTTT. Deletion right flank: TTTTACTTGACTCTCTGAAAGTCGAACAGA. Insertion Sequence: TTACTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2398 |
C. elegans |
gcy-14(ok2236) V/nT1 [qIs51] (IV;V). Show Description
ZC412.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2236 homozygotes (sterile flaccid Unc). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTGGATTTTTCCGGCTACAA. External right primer: AGAAAGCATTTGTGGCATCC. Internal left primer: GCAACCACGGAACCTTAAAA. Internal right primer: TTTTGTCACTGGTCTCACGC. Internal WT amplicon: 3253 bp. Deletion size: 2733 bp. Deletion left flank: TCATTCTGCTCAATAATTCCATCAAAAATT. Deletion right flank: CTCACATCGCATATGTATAACACTTTTCCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2399 |
C. elegans |
sas-6(ok2554) IV/nT1 [qIs51] (IV;V). Show Description
Y45F10D.9. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2554 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCATGAGAATCCCCGTTGT. External right primer: ACGGGATAAGTGGCTCACAC. Internal left primer: CGGAGGACTCCCAACTGATA. Internal right primer: TGAAAATGCGGGAAACTCTC. Internal WT amplicon: 2129 bp. Deletion size: 1435 bp. Deletion left flank: TATTGTCACGGAATGGGGTGCGCTGAAATT. Deletion right flank: CTGTTACTTTTGAAAATCGTTTGCTCCCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2402 |
C. elegans |
htz-1(ok3100) IV/nT1 [qIs51] (IV;V). Show Description
R08C7.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3100 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGACGACATGTTTCTTGA. External right primer: CGATTTTTCCCAATGTTCGT. Internal left primer: GCTCCGCCGTAAATCTACAC. Internal right primer: GCCAAAATTTCCAATTTCCA. Internal WT amplicon: 1244 bp. Deletion size: 449 bp. Deletion left flank: TTTTCCTGTTCATTTGTGCATAAATTGCAC. Deletion right flank: CTCGAATATCTCACCGCCGAAGTCCTCGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2420 |
C. elegans |
lam-1(ok3139) IV/nT1 [qIs51] (IV;V). Show Description
W03F8.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3139 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTCGATCTCGAAAAATCGG. External right primer: CTTTCGGCTTTCTGTCCAAA. Internal left primer: CTAACCTCACCCGTGGAGAA. Internal right primer: CCTGAGTATTGTTGCCAGAATTT. Internal WT amplicon: 1143 bp. Deletion size: 536 bp. Deletion left flank: TCCCGTTGGATGGGAGAATATTCAAATTAC. Deletion right flank: ATGGATTCGGACCATCTGGATGTAAAAAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2426 |
C. elegans |
mak-2(gk1110) IV. Show Description
C44C8.6. The gk1110 deletion allele in this strain was identified and isolated using PCR, and its breakpoints were determined by capillary sequencing of PCR products. Its presence was confirmed by the Vancouver Gene Knockout Lab by CGH (comparative genome hybridization). External left primer: ACTCTGTGCCACCAAAAACC. External right primer: CATATCCGTCCATTGTTCCC. Internal left primer: TGTCCTGCTTCAGTTTCCCT. Internal right primer: CATTGGTTGTCCGTGTTGAG. Internal WT amplicon: 1976 bp. Deletion size: 1024 bp. Deletion left flank: GAATTTTTAAATCAAAACTATTTGTTCCAA. Deletion right flank: GCGTATGACTAAGTCTATGCCTAAGCCTAA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2432 |
C. elegans |
bed-3(gk1173) IV. Show Description
F25H8.6. Identified by PCR, validated by CGH. External left primer: CAGAGGCTCAGTTTCCGTTC. External right primer: GGTTTGGATGAAGGGGATTT. Internal left primer: TGCCAGACTTCAAACACTCG. Internal right primer: TGTGACCACGGACAGAAGAG. Internal WT amplicon: 2425 bp. Deletion size: 946 bp. Deletion left flank: GAAAATTGAAGATGATCATAAAATTCATAT. Deletion right flank: ACAAGACTGAATGGGAATTTGAGCCACCGC. Insertion Sequence: TGCCTTTGTTCGATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC2438 |
C. elegans |
pax-2(ok3078) IV. Show Description
K06B9.5. External left primer: AGGCTAATGAAACGTGCCAA. External right primer: AATTTTCGAGTCGTTGGTCG. Internal left primer: ACAGAGAAATGGCGAGTTGC. Internal right primer: CACGTGGGTAATGTGGTACG. Internal WT amplicon: 1183 bp. Deletion size: 527 bp. Deletion left flank: AACTAAAAAGTGTACTTTATTGAGATTATA. Deletion right flank: GTGTTCTCCGACAAGTCCAGTAGGATAGAC. Insertion Sequence: GTGTACTTTATTGAGATTATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|