More Fields
Strain Species Genotype
VC2394 C. elegans pqn-90(gk1086) IV. Show Description
Y73F8A.8. External left primer: ACAACCCGTGCAAGAAAAAC. External right primer: AAGTGGGACGGAACTGTTTG. Internal left primer: ACAATCGCGTCAGTAGGAGC. Internal right primer: CAGGGTTGTAGGACGTTGGT. Internal WT amplicon: 1894 bp. Deletion size: 519 bp. Deletion left flank: AACTGAAGGTTCTAGGATGACAGTCACAATTTGTGGAGCAACAACTGGAGATTGGCATG CTGATTGGCATTGCTGACATTGTGGAGCAGCTGGTTGCTGACATTGTGGAATACATTGT TGTTGGCACTGTTGAGTCTGTTGGCACGAAGTTTGACATTGTTGGCAAGCTGGTGCAGA TGGAAGTGTGCATTGTGGAGCACACTGTTGCTGGCAAACTGGAGCATACTGCTGGCAAG TATTCTGGCACTGCTGGCACTGTGGAGCTGATGGCTGTTGGCA. Deletion right flank: CACTTGGTAAGTTACTTGCTGAACTGGTTGGGCACATGAGCAGGATGTCTGGACTGGAG CAGTGTTCTGACACGAACAACTGTACTGTTGTGGTTGAGTTGCTTGTTGGCATGAACAA CTTGGTTGAACTTGTGAAGCACAACCACATGATTGACGTTTATCACGAATTGAA. Validation: No CGH probes for gk1086. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807