Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
VC2792 C. elegans sar-1(ok3513) IV/nT1 [qIs51] (IV:V). Show Description
ZK180.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3513 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTATGCACAAACGTCGAAGG. External right primer: TTCTCACCCCCATTTAACCA. Internal left primer: ATCCCAAGGATCCCAAAAGA. Internal right primer: AAAATGCCTGATTTACCCGA. Internal WT amplicon: 1167 bp. Deletion size: 425 bp. Deletion left flank: ATTCCTTCTCCGTATCCTTGTCGCTGAAGA. Deletion right flank: TCGTATGTGGTAAACGAAATTCCTCCGAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2795 C. elegans F36H12.9(gk1123) IV. Show Description
F36H12.9. Identified by PCR, validated by CGH. External left primer: TGTTGTGGAAGTGCAAGAGG. External right primer: CGTATCGGTTAGTCGGCATT. Internal left primer: GCCTCAGCGATATGGAGAAG. Internal right primer: AGAAATCCTTTGTCGATGCG. Internal WT amplicon: 1008 bp. Deletion size: 761 bp. Deletion left flank: TACTCCGCCTCAGCGATATGGAGAAGTTTG. Deletion right flank: ATATATTGTTTTCAGTACTTGGATACTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2802 C. elegans K11D9.3(gk3223) III; srv-13(gk3224) IV; hlh-34(gk1211) V. Show Description
This strain is homozygous for a deletion (gk1211) in T01D3.2, detectable by PCR using the following primers. External left primer: GTGAAGCCGAAGGATCATGT. External right primer: CGTCTTTGCTTTCTTTTCCG. Internal left primer: GAAGAACTTTGCATCGAGGG. Internal right primer: TGTCCAACAATTTCCAACGA. Internal WT amplicon: 1737 bp. Deletion size: 301 bp. Deletion left flank: TTAAAAAACAGAAAAAAAATTAAAAATATA. Deletion right flank: CATCTCCGCGCCTGTCCAGTATCACAAAGA. Validation: gk1211 passed by CGH. Other deletions (gk3223, gk3224) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2806 C. elegans F27C8(gk1165) IV. Show Description
F27C8. External left primer: CTGGAGCATTTGATTCGGTT. External right primer: ATTCATAAACTGGGAGGGGG. Internal left primer: TCCTCAACTTCGCTTCGAGT. Internal right primer: ATTTCGAACTTCATGCGGTC. Internal WT amplicon: 2141 bp. Deletion size: 227 bp. Deletion left flank: TCTTGATTCGATTTCACAGTGATGAATCAA. Deletion right flank: AATGTTTACATTTCCATTTCCAGGTCGATT. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC281 C. elegans hsp-12.6(gk156) IV. Show Description
F38E11.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2839 C. elegans T05H4.11&atp-4(ok2678) V/nT1 [qIs51] (IV;V). Show Description
T05H4.11. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2678 homozygotes (early- to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGATTTTGAAGCTCGACGTG. External right primer: CGTAATGGCCTCATTCGTTT. Internal left primer: ATTCGAATGGAACCGAGTCA. Internal right primer: TTTCCCGTTTGTAACCTCCA. Internal WT amplicon: 2683 bp. Deletion size: 1414 bp. Deletion left flank: TTGTGTTTCAAATCGGACACTCTGCAAAAT. Deletion right flank: CCTTAGCAGCTTCAAAGTTAGTTGGGAGCT. Insertion Sequence: TCGTTTATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2840 C. elegans C24D10.4(ok3613) IV/nT1 [qIs51] (IV;V). Show Description
C24D10.4. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3613 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCGATGAGAACATCATCCT. External right primer: TCCTATTACATCGCCGTTCC. Internal left primer: AAATCAGAAAATCCGAAGAAAA. Internal right primer: CGACTTCCAGAGGATTGTCC. Internal WT amplicon: 1195 bp. Deletion size: 418 bp. Deletion left flank: TTGTCAATGGAGCGCGCTTACGCAGCTAAA. Deletion right flank: AGTTCCCCGGATTTCCCAGCGAATTTCCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2854 C. elegans H43I07.2(ok3654) V/nT1 [qIs51] (IV;V). Show Description
H43I07.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3654 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGACCTACGACGAATGCACC. External right primer: GGCAATTAACCGAAATCGAA. Internal left primer: AAATCCAAGTGGCAATGGTC. Internal right primer: GCAAATTGCCGAAAAAGAAA. Internal WT amplicon: 1310 bp. Deletion size: 688 bp. Deletion left flank: TTCTGCCGCTTCGTGTGGATCCACGTGGAT. Deletion right flank: ACATCTACCTATATTCAGTATATTTAGACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2878 C. elegans F29B9.2(ok3628) IV/nT1 [qIs51] (IV;V). Show Description
F29B9.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3628 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCAGCTTATCAAGCACACGA. External right primer: AACCGCGTGAAAGAATATGG. Internal left primer: CATCTCCGGACACCACTACA. Internal right primer: GCTTCTTCATGAGGCGATCT. Internal WT amplicon: 1193 bp. Deletion size: 823 bp. Deletion left flank: ATCAAGGAAGGTCAGACACTGCTCATCCCG. Deletion right flank: ACTATTGTGGATCCCATCTCGAAGCACGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2879 C. elegans glb-3(ok3630) V/nT1 [qIs51] (IV;V). Show Description
C06H2.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3630 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTGTGAACAAATGGGCAA. External right primer: AATGCGATTGAGATGAAGCA. Internal left primer: TCGAAGAATGAGTCGAGCAA. Internal right primer: TGGACCTGAAAACCAAATGA. Internal WT amplicon: 1341 bp. Deletion size: 975 bp. Deletion left flank: ATTCCTAAAAACGAATTAACCCAAAGTTTG. Deletion right flank: AATGACAGTCTAGGTGTATCTAGAAATATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2901 C. elegans F52C12.2&F52C12.6(gk3019) IV/nT1 [qIs51] (IV;V). Show Description
F52C12.2, F52C12.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3019 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTCTATTTTTCCCCCGAAG. External right primer: TTGCATCTTGCGGTAGACAG. Internal left primer: TTCGGAGCTTCGTTGTTTCT. Internal right primer: ATCCCGTCTCAATTGTCGTC. Internal WT amplicon: 3351 bp. Deletion size: 2297 bp. Deletion left flank: AATTTTAAAATTTTAATTCCTTGTGGCAAA. Deletion right flank: CGACTCGGAAGGCGAAATGGATTTTGAGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2913 C. elegans cTe154X.1(gk3136) III; flp-10&T06C10.3(gk3137) kin-26(gk1263) IV. Show Description
T06C10.4, T06C10.6, T06C10.3, cTe154X.1. The gk1263 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GATGGAGTCGGTGGTGTTCT. External right primer: ATTTTTCAACTGCGAGCGAT. Internal left primer: GCTGGCAGTATTCGGATGAT. Internal right primer: AAATTTGCCGAAACGTGAAC. Internal WT amplicon: 2806 bp. Deletion size: 1036 bp. Deletion left flank: ACAAAATAAACGAGTTTAAAAAAACATTCA. Deletion right flank: TAACAAGGTACAATGGTTCCTGTAGTACTC. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2919 C. elegans clec-198(gk3149) IV; W03G11.3(gk1251) X. Show Description
C49C3.13, W03G11.3. The gk1251 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AATGGAAAACGTTTGAACTTTGTAG. External right primer: AATTCAATCCATCATTTTCTGTGTT. Internal left primer: CATTGCCAAAAGGTGTCATAAA. Internal right primer: CCATCTTGGTACGATGACTCAA. Internal WT amplicon: 2027 bp. Deletion size: 969 bp. Deletion left flank: TATGATACAATGACTAAATATCGTAATCAG. Deletion right flank: TCCCCAATGACAGAATATGCCAAACTTTGA. The gk3149 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC292 C. elegans +/nT1 IV; sun-1(gk199)/nT1 V. Show Description
F57B1.2. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous gk199 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2921 C. elegans F55G1.5(gk1250) IV; pgp-10(gk3148) X. Show Description
C54D1.1, F55G1.5. The gk1250 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: GCACGTTGCGAAGTAGATGA. External right primer: GCGGTACAACGATTGAAGGT. Internal left primer: TCGTTGCCTGTTGTATGGAA. Internal right primer: CCGATGAAATGGCAAAATCT. Internal WT amplicon: 1387 bp. Deletion size: 621 bp. Deletion left flank: AGTCGTAATCACCACACCAATGGAGCTATT. Deletion right flank: TGCGTCGGTTTCGCCTAGAGCATTTATTTT. The gk3148 allele was identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2928 C. elegans C35D6.4(gk1282) IV. Show Description
This strain is homozygous for a deletion (gk1282) in C35D6.4, detectable by PCR using the following primers. External left primer: GCCCAGGATGACAGTTGTTT. External right primer: GACCTGTGGATCCTCCTTCA. Internal left primer: TCATCATGAGTGGTCGTTCC. Internal right primer: TTGAAGTGAGACGGTCCTCC. Internal WT amplicon: 1678 bp. Deletion size: 552 bp. Deletion left flank: AGTTACTATTACTTTTCGATCCCGCCACTT. Deletion right flank: GAAAAAGAAAGAAGAAGCATTCAAGACATC. Validation: gk1282 passed by CGH with low log2 scores. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2933 C. elegans C35D6.4(gk1281) IV. Show Description
C35D6.4. External left primer: GCCCAGGATGACAGTTGTTT. External right primer: GACCTGTGGATCCTCCTTCA. Internal left primer: TCATCATGAGTGGTCGTTCC. Internal right primer: TTGAAGTGAGACGGTCCTCC. Internal WT amplicon: 1678 bp. Deletion size: 552 bp. Deletion left flank: TGTTACTATTACTTTTCGATCCCGCCACTT. Deletion right flank: GAAAAAGAAAGAAGAAGCATTCAAGACATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2934 C. elegans F38C2.7(gk1244) IV. Show Description
F38C2.7. External left primer: TGCTCCAGTGTGCACAAAAT. External right primer: TTCACAGAGAGTGTGGCCTG. Internal left primer: AAGAGCTGAGCAATGCCAAT. Internal right primer: TGTTGAAGCAAGCAACCAAG. Internal WT amplicon: 598 bp. Deletion size: 392 bp. Deletion left flank: CACCTGATTCCGTACTTGCAATGCCCAGTT. Deletion right flank: TTCTTGGTTGCTTGCTTCAACAGACATTGT. Insertion Sequence: CTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2935 C. elegans gcy-27(gk1267) IV. Show Description
C06A12.4. External left primer: CTTCCGAAAAAGCTGTGGAG. External right primer: TCGGTTTTAGGTGCAGCTTT. Internal left primer: TTGCAATTGCGTTTCGTAGA. Internal right primer: TGCATTGATACCTTTCGCTG. Internal WT amplicon: 2701 bp. Deletion size: 1198 bp. Deletion left flank: TTGTGACCCCATATAATGCAATTTTCAGTA. Deletion right flank: CCGATACTTGATGAGTATGTTCACAACTAC. Insertion Sequence: GGTGACACTGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2936 C. elegans kin-26(gk1261) IV. Show Description
T06C10.6. External left primer: GATGGAGTCGGTGGTGTTCT. External right primer: ATTTTTCAACTGCGAGCGAT. Internal left primer: GCTGGCAGTATTCGGATGAT. Internal right primer: AAATTTGCCGAAACGTGAAC. Internal WT amplicon: 2806 bp. Deletion size: 783 bp. Deletion left flank: CGGCTTGATCTGATAAACAGTTCCATTTCG. Deletion right flank: GATTGACTAGCATACAACCTTCTTTGATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC295 C. elegans unc-30(ok613) IV. Show Description
B0564.10. Unc. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2958 C. elegans sqrd-1(ok3696) IV. Show Description
sqrd-1. Homozygous viable deletion, detectable by nested PCR. External left primer: TCCGTTGTCCTGCTCTTTTT. External right primer: CCTGTAATGACCCACCATCC. Internal left primer: CCAGATATCATACAAACCCCG. Internal right primer: CCAGTTTTATCGACAAATGCC. Internal WT amplicon: 1346 bp. Deletion size: 850 bp. Deletion left flank: GAAATCCGCGGAAGCTATTTTGTACCAGAT. Deletion right flank: CGTTTCCAATAAATCGTTAAAAATAAAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2975 C. elegans bath-5(gk3138) II; Y41D4B.26(gk1259) IV; unc-83(gk3139) V. Show Description
W01A11.3, Y41D4B.26, F07E5.7. The gk1259 allele was identified by PCR and validated by CGH, and can be detected with PCR using the following primers. External left primer: AGAGTTCGGGGCTGATTTTT. External right primer: AGGAGGGACTTTTTAGGCCA. Internal left primer: AACTGAGCCACTCGGGTAAA. Internal right primer: TGCTGATTGGAAGAAGTGGA. Internal WT amplicon: 2165 bp. Deletion size: 1624 bp. Deletion left flank: CTGAGCCACTCGGGTAAAACTAAATTTTTT. Deletion right flank: ATTTTTTTCTAGAAACTGGACCGGCGAAAA. Insertion Sequence: CCCTTTCCCCCC. Other lesions identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2998 C. elegans T09E8.1(ok3692) V/nT1 [qIs51] (IV;V). Show Description
T09E8.1. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3692 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGGATGGACCGGTCACTAAT. External right primer: GGGGTAGGCAAACATTCTGA. Internal left primer: CGATGCTCGGATTGCTTATC. Internal right primer: CCTCAAGTTGTTCTCAGGTTCA. Internal WT amplicon: 1186 bp. Deletion size: 657 bp. Deletion left flank: AACTTGAACTGACACAAAAAGAACAGAGCT. Deletion right flank: GAATTTGAGAGAATGCGATCAGAGAAAGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3009 C. elegans ell-1(ok3699) IV. Show Description
Y24D9A.1. External left primer: TTTTTCGATGATTTTTCGCC. External right primer: AAATTTTCGACAAAAAGCCG. Internal left primer: TTAAAAATTCCGCGTTTTCG. Internal right primer: TTCAAACAAAAATCAGCCCA. Internal WT amplicon: 1340 bp. Deletion size: 717 bp. Deletion left flank: CAAGAGAAATGACTCGAAAATTTTAAATAC. Deletion right flank: CGCCGGAGCCGGCGAATAAGCGCCGTGCTC. Insertion Sequence: AAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3010 C. elegans uaf-2(gk3159) IV/nT1 [qIs51] (IV;V). Show Description
Homozygous lethal deletion chromosome (gk3159 in Y116A8C.35) balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3159 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCTGAGCAGTTTGCAGGTG. External right primer: TTTCTGTAAAAATTGGCCGC. Internal left primer: CTCCATATCCGTAGCCTCCA. Internal right primer: GATGCAAGAGACGCAGAGAA. Internal WT amplicon: 2193 bp. Deletion size: 871 bp. Deletion left flank: CCGCCTCCGGAACCTCCACGTTGTGATGGA. Deletion right flank: AGTGGCACGTTCTCTTCACAGCACTTGAGC. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3013 C. elegans rack-1(ok3676) IV. Show Description
K04D7.1. External left primer: CCAGGTTAAAGGCGCATAGA. External right primer: CTTGAGACCAGGCCAAAGAG. Internal left primer: GACGCGAATTTTTAGGACGA. Internal right primer: TGAGCTCCTCGATCTCCTTC. Internal WT amplicon: 1192 bp. Deletion size: 591 bp. Deletion left flank: TCGCTCACTGGACATAACCACTTCGTCTCT. Deletion right flank: ACGACGTCATCAACGCCATGTCCTTCTCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3016 C. elegans ZK354.2(gk1288) F01G4.3(gk3110) IV. Show Description
This strain is homozygous for a deletion (gk1288) in ZK354.2, detectable by PCR using the following primers. External left primer: GCCTCCCCCTATCGATAAAC. External right primer: TCGTCTTGTTGTTCTTCCCC. Internal left primer: TGAACATGAAGAGCTCGGTG. Internal right primer: GTACCCGGGACCCTTGTAAT. Internal WT amplicon: 1294 bp. Deletion size: 770 bp. Deletion left flank: AACATGAAGAGCTCGGTGAGTTATTGATGG. Deletion right flank: CCAAGAAAAACGATGAAGCTGAGGAGCAGA. Validation: gk1288 passed by CGH. Other deletion (gk3110) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC302 C. elegans rib-1(ok556)/nT1 IV; +/nT1 V. Show Description
F12F6.3. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok556 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3027 C. elegans clec-70(ok3725) IV. Show Description
Y46C8AL.3. External left primer: AAAAACCCTGACCAAAGGCT. External right primer: AATCGCATGGTTACGCAAAT. Internal left primer: AGACTGACATCCCACAAGCA. Internal right primer: ATTCGGAATCAGGGGAAAAT. Internal WT amplicon: 1151 bp. Deletion size: 507 bp. Deletion left flank: TTCATTGCTTCCAATACACCATCCGGCGGC. Deletion right flank: TGCTAATCTTGATGCTTCCGGTTTCGCTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC303 C. elegans +/nT1 IV; stdh-4(ok543)/nT1 V. Show Description
F25G6.5. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok543 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3031 C. elegans skr-10(ok3719) IV. Show Description
Y105C5B.13. External left primer: CTTGACGGCATTTCTCATCA. External right primer: CATCGCACAAAATTGCAAAC. Internal left primer: ACTTTTTGAACAAACGCAGC. Internal right primer: CGCAAAAGTGGCATGGTATT. Internal WT amplicon: 1292 bp. Deletion size: 741 bp. Deletion left flank: TCAAATGATGGAACAGTTTTCGAAATCAGT. Deletion right flank: AAGTTTTTATTTAACCAAAAGCAATTACGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3034 C. elegans srgp-1(gk3017) IV. Show Description
This strain is homozygous for a deletion (gk3017) in F12F6.5, detectable by PCR using the following primers. External left primer: GAAGTCACTTGAAGCATCAGAAAA. External right primer: TCAGAATCAAGCTTCTTTGTTGAG. Internal left primer: TCAAAAACCAATTTCGTTAGAGC. Internal right primer: TGATTTTTATTGCCTTTTTCCAA. Internal WT amplicon: 2179 bp. Deletion size: 1203 bp. Deletion left flank: GTACCAAAAAAAGAGAGAATGCGTCTTCCT. Deletion right flank: GATGATAGATTCTACATATGAATCAGCTGA. Validation: gk3017 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3042 C. elegans C06A12.3(ok3746) IV. Show Description
C06A12.3. External left primer: CAATGCAACGCCAATTGTTA. External right primer: CTCATCAATGCCTTGCTCCT. Internal left primer: TCCATTGTTTGAAGAGTGCTG. Internal right primer: CGAATTGGCTAAAAACTCGAA. Internal WT amplicon: 1192 bp. Deletion size: 336 bp. Deletion left flank: TATGTTCCATTGTTTGAAGAGTGCTGTTCT. Deletion right flank: TGAATAGAAAACGTCACGAAGTGGTGAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3046 C. elegans aly-1(ok3754) IV. Show Description
C01F6.5. External left primer: CAACTCCCCCAAATTGGTAA. External right primer: GACGAAGGGATGATATGGGA. Internal left primer: TTTTTGATGTCACCTACCTATTCTA. Internal right primer: TTTGTTCGCCGTTCAATATG. Internal WT amplicon: 1251 bp. Deletion size: 617 bp. Deletion left flank: TCTCCAGATACTCCATCCACCTAGTCTATC. Deletion right flank: CGTGAACTTCAACGAGCACGGAAAACCAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3054 C. elegans F52B11.2(ok3718) IV/nT1 [qIs51] (IV;V). Show Description
F52B11.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3718 homozygotes (early- to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTCCTGAAATATGGCGGAGA. External right primer: TCTTCTGGCCCTTCAACAGT. Internal left primer: ACACGAAGCACTGGCTTTTT. Internal right primer: GTCCGACAGTCCGTTCGT. Internal WT amplicon: 1267 bp. Deletion size: 518 bp. Deletion left flank: AATGTATTATTTTCCATTTTCCGAATTTTT. Deletion right flank: CGGATTCAAGGGCACCGAACCGTATCCAGT. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3058 C. elegans thn-1(ok3735) IV. Show Description
F28D1.3. External left primer: TTCCTATCAATCACCCCCAG. External right primer: AGTTTTACGCGGCTGTTGTT. Internal left primer: TTTCCTAAACCTTACGGCCC. Internal right primer: CCGTGTTCCTTTTGAAGCTC. Internal WT amplicon: 1285 bp. Deletion size: 583 bp. Deletion left flank: TTTAGCATGAACTTTCAGAACTCGGAGCAA. Deletion right flank: CAGTTGATACCTTTCTACTATCGAATGACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3062 C. elegans F25H8.2(ok3636) IV/nT1 [qIs51] (IV;V). Show Description
F25H8.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3636 homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGCAAACATGCTCCAATGA. External right primer: ATTATCCGATCTGGCAGGTG. Internal left primer: AACAAACGACACTCCGATTTC. Internal right primer: ATCTCGTTTTCGCCCTCTGT. Internal WT amplicon: 1333 bp. Deletion size: 333 bp. Deletion left flank: GAATGATTAGATTTCTAGCGTAATGTTCAC. Deletion right flank: AGAAGTTTTATAGGCATCGATGATACCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3070 C. elegans rab-1(ok3750) V/nT1 [qIs51] (IV;V). Show Description
C39F7.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3750 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTTACGACGTGAATTTGGGG. External right primer: TTCTTGCACTGTTCGTCTGG. Internal left primer: AGGGGAGAGAAAAGACAGCA. Internal right primer: CTCCTGTTGCTGACCGATTT. Internal WT amplicon: 1245 bp. Deletion size: 538 bp. Deletion left flank: ATAATCCTGGGCAGCTTGAGTCTCCACAGC. Deletion right flank: AAATTGGGAAAAAAATTGTTAGAAACCGAA. Insertion Sequence: AGCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3083 C. elegans unc-22(gk3076) IV. Show Description
Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3084 C. elegans C34B4.1(ok3727) V/nT1 [qIs51] (IV;V). Show Description
C34B4.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3727 homozygotes (Unc, mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTGCAGCCGAAAGTATCGT. External right primer: TGGACTGACTTCAGACGACG. Internal left primer: AAGGCATAAGCTGCTCCTTG. Internal right primer: GCCTGAAAACAAAGCAGGAA. Internal WT amplicon: 1143 bp. Deletion size: 711 bp. Deletion left flank: GTGACAGATCGAATATCTGATATACTGATT. Deletion right flank: CTTCAATGTCATACTCGTAATCTTCCGCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC309 C. elegans tag-65(ok535) V/nT1 (IV;V). Show Description
F58G11.5. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok535 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3092 C. elegans ethe-1(ok3755) IV. Show Description
C33A12.7. External left primer: ATGTCCTTTTCCATCCACCA. External right primer: CACGTCTATTTTGGCCGTTT. Internal left primer: TTTGCAGGAACCGCTTTATC. Internal right primer: GCAGGTAGACATAGGCAGGTG. Internal WT amplicon: 1353 bp. Deletion size: 748 bp. Deletion left flank: CGATTTTGAACTGAGCACTGACTTCATTGT. Deletion right flank: ACATCTCTTTCATATGCACGAAAATGTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3108 C. elegans mel-46(ok3760) IV. Show Description
T06A10.1. External left primer: CAGCTTGTCTCCCGAATCTC. External right primer: AGGCCAACAATAGCCAAAAA. Internal left primer: CTCGTCTTTCTCGCGTTTTC. Internal right primer: TTTGAGCAATTCTGGACTAAAAA. Internal WT amplicon: 1270 bp. Deletion size: 448 bp. Deletion left flank: GACGTGAAGGCTTCACGAATGTGTTGGAGC. Deletion right flank: ACAGAAAAATGGGCGGGGCACAGTTTTGCA. Insertion Sequence: AGAAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3115 C. elegans srgp-1(gk3182) IV. Show Description
F12F6.5. External left primer: GAAGTCACTTGAAGCATCAGAAAA. External right primer: TCAGAATCAAGCTTCTTTGTTGAG. Internal left primer: TCAAAAACCAATTTCGTTAGAGC. Internal right primer: TGATTTTTATTGCCTTTTTCCAA. Internal WT amplicon: 2179 bp. Deletion size: 470 bp. Deletion left flank: AATGGAAACCTCATGGAAAGACTCGAAGCA. Deletion right flank: TATTCCCAATATTCATGTTCGAACAGTTTT. Insertion Sequence: CTCGATATTCTCTTCGTAATCAGGGATTATTCCGAGTTTCTGGTTCACAATCGGAAATT AATCGATTCAGAGAAGCTTATGAAAGAGGAGAGGATCTATTCCAGTATCTGGGAGGATC TATTCCAGTATCTATTCCAG. Validation: gk3182 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3121 C. elegans T07D10.1(gk3249) I; F59E12.3(gk3183) II; Y116A8C.5(gk3250) IV; unc-83(gk3251) gkDf35 V; gkDf32 X. Show Description
This strain is homozygous for a deletion (gk3183) in F59E12.3, detectable by PCR using the following primers. External left primer: GCATGCAAGAAATGCAAGAA. External right primer: TGAAGTCGCGCACAAATAAG. Internal left primer: TCACAAATGGAAACGTGTGG. Internal right primer: CAACGAGGCCAAAGTGATTT. Internal WT amplicon: 1320 bp. Deletion size: 585 bp. Deletion left flank: GAACTGACAACAAGTATCTCAACCTACACG. Deletion right flank: CCCCCGTTTATGCGCCCAGGGCATCCCACA. Validation: gk3183 passed by CGH. Other deletions (gkDf32, gkDf35, gk3249, gk3250, gk3251) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3123 C. elegans kin-21(gk3184) IV. Show Description
This strain is homozygous for a deletion (gk3184) in W08D2.8, detectable by PCR using the following primers. External left primer: TGAACCATTTCACTAGCCCC. External right primer: GCTCTATCCGTTCTTCGTGC. Internal left primer: AATGATGTTCGGAAAGGCTG. Internal right primer: CATTCGGGAGTAGATGCGAT. Internal WT amplicon: 2184 bp. Deletion size: 652 bp. Deletion left flank: ATTCTCCAAAGGATTATTCAATGAGAAAAC. Deletion right flank: CTAAGTGAACTCATGTAATCAACAAAATAG. Validation: gk3184 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3127 C. elegans Y41D4A.5(gk3186) IV. Show Description
This strain is homozygous for a deletion (gk3186) in Y41D4A.5, detectable by PCR using the following primers. External left primer: TTTTTATCAGGTGGAAAATGGG. External right primer: GTTATTCGTGTGTTGCCTTGAA. Internal left primer: CGGAGAAAAATTGTGTGGAAA. Internal right primer: TTTCTTCATTTCTCAGCCGAA. Internal WT amplicon: 784 bp. Deletion size: 232 bp. Deletion left flank: AATTCGTGTTTTTTAGCCTAAATTTTCGCT. Deletion right flank: TCAAGTTTTTCAGTGAAAAATTTGAAAAAA. Validation: gk3186 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC313 C. elegans +/nT1 IV; ttn-1(gk171)/nT1 V. Show Description
W06H8.8. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous gk171 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC3135 C. elegans F11E6.1(gk3287) IV. Show Description
F11E6.1. External left primer: AAAAACGTTCTAAGGCTAAATTGCT. External right primer: AAATTCAGCACAATAGAGAATCCTG. Internal left primer: CGGTTTTAATGGCTCCAAAA. Internal right primer: CTTGAGCAGTTCGGTTGACA. Internal WT amplicon: 2099 bp. Deletion size: 464 bp. Deletion left flank: TTTTAAAAGATTTTTCGAAGCCTATTCATC. Deletion right flank: ATTCATCATGGCCCATTAATGGGTGACTGG. Validation: gk3287 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807