sEx12047 [rCes C33A12.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14160 [rCes C33A12.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx547 [C33A12 (IV) + pCes1943[rol-6(su1006)]]. "low" ng/ul C33A12 + 83 ng/ul pCes1943[rol-6(su1006dm)] injected into hermaphrodite from BC842 (N2 male strain). pCes1943 carries rol-6(su1006) [an EcoRI insert from pRF4] and a kanamycin cassette. Select Rollers to maintain. Presence of cosmid confirmed by PCR. This transgenic strains were constructed in collaboration with the C. elegans Genome Sequencing Consortium Labs in St. Louis, MO and Hinxton, Cambridge, UK. Funding for the creation of this transgenic strain was provided by a grant to Ann Rose and David Baillie from the Canadian Genome Analysis and Technology Program (CGAT), and from a grant from NSERC (Canada) to David Baillie. If you use this strain in work which you publish, please acknowledge these grants.

Homozygous viable. Deletion of 1844 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATATATTGGAAATTTCTAAATTTAAAGCCA ; Right flanking sequence: TGGTCGGTTTGTACCATATTCCACATGACT. C33A12.3 sgRNA #1: GGGCTGGGCACTATTGACAC; C33A12.3 sgRNA #2: TGACGATCTCGAGAAAGCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

C33A12. External left primer: CGTTGAGAGCTCCACACAAG. External right primer: GAAATTGAGCACAAAAGGGG. Internal left primer: TGCATAACGGCTTCAGTCAT. Internal right primer: GCTAGCGAGCCTCTTACAGC. Internal WT amplicon: 1141 bp. Deletion size: 344 bp. Deletion left flank: TACCAAATGGGTGCAACTTTGTAATATAAT. Deletion right flank: CTAACTGACATGCCAAAAAATCTGCGCGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C33A12.7. External left primer: ATGTCCTTTTCCATCCACCA. External right primer: CACGTCTATTTTGGCCGTTT. Internal left primer: TTTGCAGGAACCGCTTTATC. Internal right primer: GCAGGTAGACATAGGCAGGTG. Internal WT amplicon: 1353 bp. Deletion size: 748 bp. Deletion left flank: CGATTTTGAACTGAGCACTGACTTCATTGT. Deletion right flank: ACATCTCTTTCATATGCACGAAAATGTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1803 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGGCCAAGATATTTTACGACATCACCACCC; Right flanking sequence: GCAGTTTAGTGCTCCACGAATTAAATTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.