Search Strains

C34D4.9. External left primer: ACCATTATCCCACAAATGCC. External right primer: TGGAAGCTTCACATCACTGC. Internal left primer: TACACGAAAATGGCCAAATG. Internal right primer: ATTGGTACATCAGATTCATTTTTAA. Internal WT amplicon: 1132 bp. Deletion size: 422 bp. Deletion left flank: CTGCGTTCGATTTGTTCCTAGAACCGCTGT. Deletion right flank: TTGTATTTGCACAGTATAGATTTGCAAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C05C12.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H16O14.1. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3074 homozygotes (sterile with no eggs, often with vulval blip). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGACGGCCAGATTCAGTAAA. External right primer: CGTAATGGCGGTTTTTGATT. Internal left primer: TTTGGTAACTTCTGGCCGTC. Internal right primer: GGGGCTTGTTTGAAAGAACA. Internal WT amplicon: 1227 bp. Deletion size: 582 bp. Deletion left flank: CAAACTAAGTATTTATTCTTTTAACATTTT. Deletion right flank: AGTAATTCTTTTTGGATGTTTCATGTCAAC. Insertion Sequence: TAAAAAGTATTTATTCTTTTAACATTCTTTTAACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Unc-22 twitcher. This strain was isolated after ENU mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk2406), it is homozygous for 206 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

Unc-22 twitcher. This strain was isolated after ENU mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to unc-22(gk2608gk2609), it is homozygous for 224 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

This strain is homozygous for a deletion (gk1161) in F39F10.2, detectable by PCR using the following primers. External left primer: GTGCTCACCGAGATGTCTGA. External right primer: GCTGATTTCGCTCAACACAA. Internal left primer: GACCCGGTAATTGAGCAGAA. Internal right primer: TGCGAACATTCGTTGAGTTC. Internal WT amplicon: 2489 bp. Deletion size: 500 bp. Deletion left flank: TTCAATTAGGATGTCGTAAACGCAGTGGCT. Deletion right flank: GTGATATCCTAAAAATTATGTTTAAGTTAT. Validation: gk1161 passed by CGH. Other deletions (gk3210, gk3211, gk3212) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y43D4A.6. Identified by PCR, validated by CGH. External left primer: ACGATAAACCAGCAGACGCT. External right primer: TTTGAAAACGGTGTGAAACG. Internal left primer: AACTGTGTTCGAAACCCTCG. Internal right primer: TCAAGCTCATTCGGATTTCA. Internal WT amplicon: 2337 bp. Deletion size: 1390 bp. Deletion left flank: CAAGTTTATCAACAACGTGAAACAGACAAT. Deletion right flank: CAGCAAAAAAATCACTTGCTCCAGTAATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F38H4.7, F38H4.8. Unc. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R08C7.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3099 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGACGACATGTTTCTTGA. External right primer: CGATTTTTCCCAATGTTCGT. Internal left primer: GCTCCGCCGTAAATCTACAC. Internal right primer: GCCAAAATTTCCAATTTCCA. Internal WT amplicon: 1244 bp. Deletion size: 559 bp. Deletion left flank: TCTTGAAGCAGAGAACCACTTCCAGCGGAC. Deletion right flank: CGTCTGTATATCAAGCATTTCAAATGTTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C17E7.8. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk1092 homozygotes (early larval arrest). Note that since this deletion is entirely in an intron, the lethality is likely not due to gk1092. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGTTGTTCATGAGCGCAAA. External right primer: TGTTTAAAAGTTGACCCGCC. Internal left primer: TAAGTCGCATTCACGGTTTG. Internal right primer: AGTCACGTCCGTCCAACTTC. Internal WT amplicon: 1629 bp. Deletion size: 240 bp. Deletion left flank: TATTTCTATTTTCCGATTTACCGGAAAATT. Deletion right flank: AAAACGTATAATCCTATCATAAAAACAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C45G7.3. External left primer: ATGCCAAAATCAAATGCACA. External right primer: CCACCTAAACACTTCCGTCC. Internal left primer: CTCCACTTCCTGTTTGCCAT. Internal right primer: TATGGGGTTTCCTGCAGATT. Internal WT amplicon: 1156 bp. Deletion size: 855 bp. Deletion left flank: TGAACTGTATCTTTGGTAGAATGGGTAGTA. Deletion right flank: CAGGGAGCATGCGAAGTGATGGCTCGTAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T11F8.4. External left primer: TGCAGGGACTACAAGCACTG. External right primer: GCGCGACAACAAGTAGATCA. Internal left primer: GATTCTTGGCGTCTTGCTTC. Internal right primer: TGGCCGATTTAACCGTATTT. Internal WT amplicon: 2247 bp. Deletion size: 645 bp. Deletion left flank: CTATTGTCGCGCCAGGACGAGAAGCAACAT. Deletion right flank: GTAGACTTCGAATTGCAACACGAAGAACTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y11D7A.4. External left primer: TGTAAATAAGACAATTTCGCCCGG. External right primer: GTCTCCTGCTCCGAGAGCTAA. Internal left primer: TGACGCCGGGATCGAGGAATT. Internal right primer: TCGTTTCCATGACGATTCTCTCGTG. Internal WT amplicon: 2420 bp. Deletion size: 998 bp. Deletion left flank: TCCAAATATGAAGGGGAAAATAATCCGATA. Deletion right flank: TTTCAAGTTTCTAAAAGGATTCAAAAAATT. Insertion Sequence: AAAAATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01F6.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22D1.10. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3232 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTGAATTCACGGTTTTGTCG. External right primer: ATTTTCCAGGTTGAACGCAC. Internal left primer: GGGACAGAGCGTTTCCAAT. Internal right primer: CGCTAGACAAGCTGCAGGAC. Internal WT amplicon: 1244 bp. Deletion size: 457 bp. Deletion left flank: AACGAAAAGCATTCGATATCAAGCATATGA. Deletion right flank: CGCATTGTGAGTTTTCCGACCTTTGGTCCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C50F7.1. External left primer: CGCATCTACGTCATTTGCAT. External right primer: ACACGTGGAAATGGAAAACC. Internal left primer: CAACACTAGCTGGGATCGAGA. Internal right primer: GGAACATGGAAAACGTTTAGTTG. Internal WT amplicon: 1330 bp. Deletion size: 752 bp. Deletion left flank: TTTCATAGTTCCATTTGGTTTGATTTCGGG. Deletion right flank: CAACAATTTCAATGTCTAATTTTGGAACTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0496.3. Identified by PCR, validated by CGH. External left primer: GATGTTGTCGCATTGTGTCC. External right primer: AACTTGATGGATCTGGTGGC. Internal left primer: TGCGCTTCTAATCGTAAGGC. Internal right primer: GGTTCCTCGTCAGGATCAAA. Internal WT amplicon: 2549 bp. Deletion size: 595 bp. Deletion left flank: AGAAACTAGACATAAATCAAGGTATTACTT. Deletion right flank: ACTAAAAGTAAAGGTTACAATTCCAAATTA. Insertion Sequence: AAATAGACATAAATCAAGGTATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y73B6BL.9. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2548 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TACAAAGGTGGGAGGTACGC. External right primer: GAGCATGATGTGACACCCAC. Internal left primer: GGGGCAAAACTATGAGAGCA. Internal right primer: TTTTGCGCTTTTTCAGTGTG. Internal WT amplicon: 2810 bp. Deletion size: approximately 1700 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52B11.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3197 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCTTAGGCACAGACGTAGG. External right primer: CACTGAGAGCGAGACGACTG. Internal left primer: GCACTGCTTCTTCCTGCTTC. Internal right primer: CAGAGAAGCTCGGTGGAGTC. Internal WT amplicon: 1129 bp. Deletion size: 806 bp. Deletion left flank: TGAATCCCAATTCGGAGGAATGGCTCTCTG. Deletion right flank: AGGAGAAGCTTTCGGCTATCATTCGAGTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C13F10.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3257 homozygotes (late larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAAGGACTCCTGATGACCGA. External right primer: CGTGGGCAGAGGTTTATGTT. Internal left primer: TCATCTGGCTGCTGACTGAC. Internal right primer: TGACTACAATGGAAGTGGTTCA. Internal WT amplicon: 1092 bp. Deletion size: 525 bp. Deletion left flank: TTTTCCACCTTCTTCGCCAGCGAACAATAC. Deletion right flank: GTTGAGAAATTGATCGGAGTAATGGGCAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K02E11.10. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3266 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGCAACTTGTCCTTGTTGGG. External right primer: GGAGTGTGCAGCAAATTTCA. Internal left primer: CTTCGAAGCCTCCTTGAGTA. Internal right primer: GCGTCTTGAGGCCATAGTTC. Internal WT amplicon: 1208 bp. Deletion size: 582 bp. Deletion left flank: CCTGAGCAGGCCCTTGCTGATATCCGGCTC. Deletion right flank: GGCAGGCTAAGATCACAACGGATTTCATCT. Insertion Sequence: TTCCCTGAACTCCTTGAGCAGATCCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T08G5.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2442 homozygotes (sterile, eggs don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTTGACATTGCACATTGGG. External right primer: CATACACGCCTTGCGAAGTA. Internal left primer: GGTAGTTTGAATCACCGCGT. Internal right primer: CTTGTTAGCCGGTGGAAGAG. Internal WT amplicon: 2794 bp. Deletion size: 1397 bp. Deletion left flank: CCACGACGGCTTTTCGATTTAAATTTCTAG. Deletion right flank: TTTCGAACAGAAAAGAATACCATTTCACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T09E8.2. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok424 hermaphrodites (Him with small broods and lots of inviable embryos). The ok424 homozygotes can be maintained. Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0513.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3326 homozygotes (late larval arrest or sterile adult, tends to explode). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAAGTCCTTCCACCGTCTA. External right primer: TTGATCAAGCACGACAAAGC. Internal left primer: AACAGAGAGCCGACACCATC. Internal right primer: TCTACGGCATTGCAGTGTTC. Internal WT amplicon: 1385 bp. Deletion size: 707 bp. Deletion left flank: TATGATCTCTATGATCTACCAAGGTTAGCC. Deletion right flank: AGTCGCTGTTCGACTACTACGGTAGCCCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41H10.10. Him, small broods of viable progeny, many arrested embryos. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

JC8.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3322 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCGGCAAAATTGGATTTCTC. External right primer: ATTCTCGATGCTCCACCATT. Internal left primer: AATAATTCCGCAACGAAACG. Internal right primer: CAACATGATCCAGGAAACGA. Internal WT amplicon: 1109 bp. Deletion size: 478 bp. Deletion left flank: AAACTGCCGAGACCATAGGTAATGTAATTT. Deletion right flank: CTTCCATCATCAGACGAGCAGAACGCGGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C10B5.1. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3270 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCATCCCGATGATCTCATTT. External right primer: GCGTCAAATATGGTGAGCAA. Internal left primer: CATTTCATGGTTTTGCTCCA. Internal right primer: TTCTCAGAATTTAGTGTTTCCGT. Internal WT amplicon: 1224 bp. Deletion size: 573 bp. Deletion left flank: TCGTAGTGTGACGTCATTCTACAGTTTAGA. Deletion right flank: CAACAAAATCGAATCGAATTCTGGATGAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0035.11. Homozygous lethal or sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3436 homozygotes (late-larval to sterile adult arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.External left primer: TTCGGACATAGTGGTTCCGT. External right primer: TTACGTTCCCCAGTGTCTCC. Internal left primer: AGCGAGGAAGACGTAGTGGA. Internal right primer: TGCACCAGGAACACCAGTTA. Internal WT amplicon: 1795 bp. Deletion size: 710 bp. Deletion left flank: GGAAGGTCATACGATGTGTAAGAACAGCTT. Deletion right flank: CTTTCGGCTTTCCTTCTCTGTCGGAATCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F29B9.5. External left primer: CTGTGAAGTATGCTGCCGAA. External right primer: TGGCAGGTACAATCTAGGGC. Internal left primer: TATTTCTGTATGCGGCAACG. Internal right primer: GGGCAAACCTAGAGAAAAACTATT. Internal WT amplicon: 1213 bp. Deletion size: 670 bp. Deletion left flank: CAACAATGTCCGAATTCATGAAAGGTGTGA. Deletion right flank: ATTATCACGTAAATATTTATATTTTAATAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09E8.6. External left primer: TGCTCTTCGTATGTTGGCAG. External right primer: CAGGCCCAGAAATTTCGTTA. Internal left primer: TCAGACTGTGTCGTTGGAGG. Internal right primer: TTTGCATCCTATGATGTGTGC. Internal WT amplicon: 1218 bp. Deletion size: 407 bp. Deletion left flank: AGGGAATAATTGCTCACGAACTGATGCACG. Deletion right flank: GTGTCAAGTACGACGACTACAACTAAGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y57G11C.16. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3353 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCTTTCGTCTCTCTTCGGA. External right primer: GGCAACACTCATGCTTCTCA. Internal left primer: TGGCTTTTTCCGTTGAAACT. Internal right primer: CTTGGACAGGAAGGTGTTGG. Internal WT amplicon: 1340 bp. Deletion size: 442 bp. Deletion left flank: GCATCTCACTAAATTTTTTATTTTTCAGGG. Deletion right flank: GCCACCCAGTTTAATTATTTTGAGAGTAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W03F8.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3221 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTCGATCTCGAAAAATCGG. External right primer: CTTTCGGCTTTCTGTCCAAA. Internal left primer: CTAACCTCACCCGTGGAGAA. Internal right primer: CCTGAGTATTGTTGCCAGAATTT. Internal WT amplicon: 1143 bp. Deletion size: 303 bp. Deletion left flank: ATCCCGTTGGATGGGAGAATATTCAAATTA. Deletion right flank: ATCGTTATCAATGTAGACATCTTGCTCTTT. Insertion Sequence: TTGTAGTGAGACCGGAAGCTGAAGGAGATGGATCATGCTCTGATGCTCCACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T27F2.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk1091 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATAGAGACCCGGATGCAAA. External right primer: AACAGGTCCAGATCCACGAC. Internal left primer: CTCACAAACCGCCATGATTA. Internal right primer: TGAACCAGAACGGACATGAA. Internal WT amplicon: 2496 bp. Deletion size: 1422 bp. Deletion left flank: ACAAGTTAGCACCTGCTCAATATATCAGAT. Deletion right flank: ACAAAACTCTTTGATGATACTGATGTATTT. Insertion Sequence: GGAGTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F32D1.2. Homozygous lethal or sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3436 homozygotes (late-larval to sterile adult arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGAATCCGAAGGTGTCTC. External right primer: GCAGCCCAGTCTGTGTTGTA. Internal left primer: GATCATCGTTATTTTCGCCG. Internal right primer: TATAGAGCCGGGCTGAAATG. Internal WT amplicon: 1263 bp. Deletion size: 791 bp. Deletion left flank: AATGTATCCAAATGGAATTATTCGAATACT. Deletion right flank: CTGGTGGGTCTCGCAACGACATGAAGGAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1105) in T22E7.2, detectable by PCR using the following primers. External left primer: GAAGGTGTGAAAAGACGGGA. External right primer: TGCAGGAAAAGCAACAAGAA. Internal left primer: TGGTCTGTAGAGCCCATTCA. Internal right primer: GTGTTGGAGAAACGTGGGAT. Internal WT amplicon: 2319 bp. Deletion size: 568 bp. Deletion left flank: TGATATTTTACTGATAATTATACACTTTCA. Deletion right flank: CTTCAAACATACGCTTCATCTTTTCGCGAA. Validation: No CGH probes for gk1105. Other deletions (gk3222, gkDf33) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57F5.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3370 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCGGAGCTAGTAGCGAAATG. External right primer: CAATTTTGGAATTCCTCCGA. Internal left primer: CTCTTCTTGTCGGCCTTGTC. Internal right primer: CCTCAATTCCGCACTCGTTA. Internal WT amplicon: 1101 bp. Deletion size: 337 bp. Deletion left flank: TTACAAGCCATGCCCATCCAACATGTACCC. Deletion right flank: GTTAACGAGTGCGGAATTGAGGGAGGAGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28F8.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3431 homozygotes (sterile, eggs don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTCCGAATTCCCTCTCACAA. External right primer: TTTCCAGGGACGATCTGAAC. Internal left primer: CTGTTGGGTCTCGGAACTGT. Internal right primer: CAACACGTGCTGAATATGATCC. Internal WT amplicon: 1270 bp. Deletion size: 509 bp. Deletion left flank: TGTACAACGACACTCCGAAATGACGCATAG. Deletion right flank: CATCGGCTCGAAAATCTGGGTGATAATGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T28F12.3. Apparent homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3565 homozygotes (arrest stage/phenotype undetermined). Any viable non-GFP progeny are not homozygous mutants but rare recombinant heterozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTGGTTGCAGTCAGGGAAG. External right primer: AAAAGCGTGCTCGACAGAAT. Internal left primer: TCGCGATTTGAAAAGTTGTG. Internal right primer: GACAATCACGAAAAGGAAGAGG. Internal WT amplicon: 1126 bp. Deletion size: 884 bp. Deletion left flank: TCTCATCATGATGTCTCGGTATTTTTTTGT. Deletion right flank: CGTATAAGAATGATATGTCAGTCGTTCAAT. Insertion Sequence: ACAAAACAAAATATGCTTGACTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55G1.8. External left primer: ACGTCACACGATCTGCACTC. External right primer: ACCGCCAATTATCTACGACG. Internal left primer: TGTTTCTGATATCGTGGCGA. Internal right primer: TACACAATCCAAGTTGCCGA. Internal WT amplicon: 2311 bp. Deletion size: 1122 bp. Deletion left flank: TAAAGATCGAATTATTCACAGATTAGTTGT. Deletion right flank: ATATGTTGGCTCAATCGTAGTCTTGAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y45F10D.12. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2217 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTCTACAGCGAACTCGGGA. External right primer: TTCCACGTATACGCCAACAA. Internal left primer: GTTGTCCGTGGAGAAGGGTA. Internal right primer: TTTTATGCAGATGGCAACCA. Internal WT amplicon: 2215 bp. Deletion size: 1161 bp. Deletion left flank: TTCTACTAGCCTAAAATTTTTTTCACGTTT. Deletion right flank: GAAGGAAGGAACAATAACGATACACTTATC. Insertion Sequence: CATATATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22D1.9. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2205 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTTGACCAACACGAACAGA. External right primer: TGACTGCGCCTTTAAACAAA. Internal left primer: TCAAGCTTCCAGGCTTCATT. Internal right primer: TGGTGGCGACTACTCAACAG. Internal WT amplicon: 2938 bp. Deletion size: 1651 bp. Deletion left flank: TATGAACAAGGGAATAGCCAAAACTCGAGG. Deletion right flank: ATGGCTTGTAAAGTGTTGTGTCCGGTTCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

AC7.1. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C25A8.5, F45H7.2. The allele gk1224 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: GTGGAGCGTTCGGTACATTT. External right primer: TCACACCCCTGACAGGTACA. Internal left primer: AACGGAACCGTTGAGAATTG. Internal right primer: GCCGCCTCACAAGTTAGTTT. Internal WT amplicon: 2303 bp. Deletion size: 1432 bp. Deletion left flank: TTTCCAACGAAAATGTGACTTTTTCAGGAA. Deletion right flank: ATCTACCCATCTTGAGATCAAAACTTTCGA. Insertion Sequence: CAATTTTATTTTAAAAAATGCTCTGTGCCGCTTTTGTCGATACAACTTCTGAAATTTTC AAAACCACCGCGGTGCCTCCCAGTAGGACTTCAAAAATTG. The allele gk3062 was identified by CGH but not confirmed by PCR. Left flanking probe: GAAAAAGATGGATCTAAGATCCACTAATAAGTGAGTACACATACAGTGTG. Right flanking probe: GAAATTTGATTCCGGACCGTATGTACGATGATCTCGATGACCTACCTCTG. Left deleted probe: ATCTACTGTTTGCAGACGACCAAAAGAAACACGTGGCAGACCTGCTCCAA. Right deleted probe: GTTATTTTGTTTTTATCAGCTTCAAGGCGGTCTACATCTGCCTTGCGCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H02I12.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC374.2, B0564.10, Y67A10A.104, T13F3.1. The allele gk1222 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: TTGGAAGTTTTGGCAGGAAT. External right primer: CTTGCGTTAATCGCATGTGT. Internal left primer: TCCAATTTGAGCGATCAGTG. Internal right primer: AGGACGCGCAGATTGTTAGT. Internal WT amplicon: 2448 bp. Deletion size: 1618 bp. Deletion left flank: CATTTTTCAGTGCTGTTTCTTCCACATTAT. Deletion right flank: TCAGATCTTCTAACTCGCGTTTCTAACTTT. The allele gk3024 was identified by CGH but not confirmed by PCR. Left flanking probe: TTTCGACTGCTGCAAATTTGGCACCTCTACCAACGTGAGTTTTACGGATA. Right flanking probe: TTGTTTGAGCTGCCGGGATGCCAGGAGGAGGGAACAGACAGAGCAGGTAT. Left deleted probe: AAAAATTATAATTTACATTTTTCCAGAGCCCAAGCTGCATTCTCCACATC. Right deleted probe: TTCCTCATCGCTCGGCCAACCTTATCAACCCTGTCAGTACAGTGGACCAC. The allele gk3025 was identified by CGH but not confirmed by PCR. Left flanking probe: GGGATTCGTGGTCGAGATTGCCAGTCCAAGGCTTGGTCGGTTTCAGGTTG. Right flanking probe: GGTTAATGTGAAACTTGATTTAACTGTTCCACGAGTATGCTTTAACAATA. Left deleted probe: TGATTCGCAAAAACAACGAATTGTATAGAACTCACACTTTAAGACATCTA. Right deleted probe: AAATTGCTTACTGACTTTGATGCAAAACAGGTGATTTTTCGGGTTCTAAA. The allele gk3061 was identified by CGH but not confirmed by PCR. Left flanking probe: CAGATTATCTCACTTACTGTTATTGCATATTGTGGGACATGTTGCTACTA. Right flanking probe: GGATCACATACTAAACTTAATTCTTTTCAGACCGCAATACCAATGCTTCT. Left deleted probe: ATATTGTGGGACATGTTGCTACTATAAAATACAACAGCAAATGAGGGTTG. Right deleted probe: ACCTACATCGTCAACTGTTCTACGCTTTGGCAATCCAGGTTTGACGCAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46E10.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk3066 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTCGATCAGCAGTTGACCA. External right primer: CAAAGTTGGCAATGGTTGTG. Internal left primer: CAACACAGTTTGCCAGTGCT. Internal right primer: GAGACGACTTGCTGGAGACC. Internal WT amplicon: 2067 bp. Deletion size: 880 bp. Deletion left flank: TTTATTTTAAAAAATATTTAAAAAGTTTTA. Deletion right flank: TATGACTGACATGCAAGTATGCTATGGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01D4.3. Identified by PCR, validated by CGH. External left primer: TCCTCCAATGGTGGTTGACT. External right primer: CCGGATGGAGACAAAAAGAA. Internal left primer: ATCACTTGCTCCGGTTTCAC. Internal right primer: CCAATTCAGTCTGATGGCAA. Internal WT amplicon: 1179 bp. Deletion size: 505 bp. Deletion left flank: TTTCTCCGCAATCGGTACAACAGTTCCAGT. Deletion right flank: CGCTATTCCAAATACATTTTTCTTTTCAGT. Insertion Sequence: TT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58E10.4. Heterozygotes are WT and segregate WT, arrested nT1 aneuploid progeny, vulvaless nT1 homozygotes, and homozygous ok537 hermaphrodites (arrest stage/phenotype undetermined). Pick WT hermaphrodites and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28D1.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3338 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAGCAGCTTGAACGACATGA. External right primer: AACATACTCGTGAATCCGCC. Internal left primer: GAGGAGGATCACTCGCTGAC. Internal right primer: GTCCAATTCCGAGCACATCT. Internal WT amplicon: 1167 bp. Deletion size: 433 bp. Deletion left flank: ACAGCTCGCCTCGAATTTCTTCCCCATCAT. Deletion right flank: CGTGTAAAGAGCCGTATTTGGTGCACAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04G2.7. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3510 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCTCCCTACCCTACCCTCTG. External right primer: CGACTCCACAGTGCTTTCAG. Internal left primer: GCCCGGTTTTACCCTGTATT. Internal right primer: TTCCGCCTCAAAAGTTTCTC. Internal WT amplicon: 1203 bp. Deletion size: 786 bp. Deletion left flank: AAAATTTTACAAATTAAGCGAATAATACTT. Deletion right flank: GCGATTACAAAATTAATTTGTATTCCTTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807