Search Strains

Y38H8A.4, Y38H8A.3. External left primer: TACGCGAGAAGCCAAAATCT. External right primer: GGAGAGCTTGTTGAGAACGG. Internal left primer: GCCGCTATTTCTGGAGATCA. Internal right primer: TACGATTATTCGCGCATTGA. Internal WT amplicon: 1637 bp. Deletion size: 1192 bp. Deletion left flank: TTGATCACCTTCGCCGCCACTTCAAGCTTC. Deletion right flank: TTGTACAGGCCTATTTCTCAGATTAAGCCT. Insertion Sequence: GAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C28D4.9. External left primer: CTATTGTTTCTTGCGTGGCA. External right primer: ACACACAGGACGAATTTCCC. Internal left primer: GAAGCAGGCATGTGTTGGTA. Internal right primer: AGCCCATTTCGATTCAACAA. Internal WT amplicon: 2019 bp. Deletion size: 790 bp. Deletion left flank: AGAGGCATGAGACAACGAAAGCGTATTCTA. Deletion right flank: TTTTTTGAAAGCTTTTCTATTTGCTATTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y116A8C.18. External left primer: CAAAAATGTTTTGTGCGTGG. External right primer: TCAAATCTGCGTGCTCATTC. Internal left primer: AATTACCCGCATGTTTGAGC. Internal right primer: CCGCTCAGAAATCATTCGTT. Internal WT amplicon: 1761 bp. Deletion size: 722 bp. Deletion left flank: TTTTCTCTGCTTCCCTGCGCGTCCTCAAAC. Deletion right flank: CATTCTCAAATAGAAACAGTTTTTTAACCA. Insertion Sequence: CATTTTCGTAGCGTTTTTCTCTTGCTTTACATCCTTTTCCAAACTTGCGATTCTATAAA TAAAAAATTTGAATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y38H8A.4, Y38H8A.3. External left primer: TACGCGAGAAGCCAAAATCT. External right primer: GGAGAGCTTGTTGAGAACGG. Internal left primer: GCCGCTATTTCTGGAGATCA. Internal right primer: TACGATTATTCGCGCATTGA. Internal WT amplicon: 1637 bp. Deletion size: 1372 bp. Deletion left flank: CGTGGTATACCGTATACGTATACGGTAGAT. Deletion right flank: TTAATTTGAATTTTGTCAGCATTTTTGAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52C12.5. External left primer: ACCTCCTCCTCCGACAACTT. External right primer: GGTTCCTGCTGCTTTGACTC. Internal left primer: CCTCCCACCACTTTGTCATT. Internal right primer: GTAGGCATGGCAGCTCTTTC. Internal WT amplicon: 1787 bp. Deletion size: 965 bp. Deletion left flank: TTTCACTTGAATCATCATTTTTGCATTTTC. Deletion right flank: AGGAGCTGGTGGAACTTTAGAAATAAGCCA. Insertion Sequence: GAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F20B10.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP tm2050 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAGTTCTGTGACGTCCCAGT. External right primer: GTCGGCGTTAGATGACTATG. Internal left primer: TACGGCAAAGTGAATGGCTT. Internal right primer: ACAGCTGATCTACCACACTC. Internal WT amplicon: 1775 bp. Deletion size: 1078 bp. Deletion left flank: CAATGAGTTAATTTCCAACAAAATTATTTT. Deletion right flank: GTAAGTGAGTACCGAACTGCTCCGGGCTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57A10.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk735 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCACTAAAAGGCTGCAATG. External right primer: TTCGATTTTTATTTTGCGCC. Internal left primer: GTCGTGGCTCAATGAGGTTT. Internal right primer: CTCAAGTTAATCCCAGGCCA. Internal WT amplicon: 2348 bp. Deletion size: 1634 bp. Deletion left flank: TGAGGTGTAGATCTTCTGATACGTGGACAG. Deletion right flank: AATTTGAGGGTGCTTATGATTTTTGGTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54D1.4. External left primer: CAGATGGTGGAGGAACTGGT. External right primer: GGTTTTGACACCTCTCCGAA. Internal left primer: CGAATTCGAGATGCCAGATT. Internal right primer: TCACGCATTGTTCGAAAGTT. Internal WT amplicon: 1953 bp. Deletion size: 1329 bp. Deletion left flank: ATATTGAAGTCTTGTTTCTACTGTGTTTGA. Deletion right flank: ACAAAAGCAAAAATTACCCTTGAAGAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54D1.4. External left primer: CAGATGGTGGAGGAACTGGT. External right primer: GGTTTTGACACCTCTCCGAA. Internal left primer: CGAATTCGAGATGCCAGATT. Internal right primer: TCACGCATTGTTCGAAAGTT. Internal WT amplicon: 1953 bp. Deletion size: 1031 bp. Deletion left flank: TTCAAATAATAGCTTTATGAACTCTCTAAT. Deletion right flank: TTCAGAAAGTTGTTTTCGTGATGATGGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04C3.5. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk760 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACCACCCATCATGTTACCGT. External right primer: GAAGCTCGTCGACCGTAGTC. Internal left primer: TCACGCATCCTTCTTCTCCT. Internal right primer: TTGCAGGGAGTTTCTATGGG. Internal WT amplicon: 1853 bp. Deletion size: 736 bp. Deletion left flank: TACTCGTCCATATACTGAGGTCGGAAGGAC. Deletion right flank: CGGACCTCCTGCATCTGAACTTTCGACAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y37E11AL.6. External left primer: AGAAGGGCGGCAATTATTTT. External right primer: TGGTGGGGAAGTGCATTATT. Internal left primer: TTGCACCATGTTGTTCCAGT. Internal right primer: GGCAGAAAAAGTGTCTGGGA. Internal WT amplicon: 3288 bp. Deletion size: 1035 bp. Deletion left flank: CGCCCGGAAGCACAGATGAACACGAAATGT. Deletion right flank: CGAATCCCGAGCCGATATTTATCTACAGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y55F3AM.13, Y55F3AM.12. External left primer: AAATCAGGGAAATATCGGGG. External right primer: TTTTCCAGGGTAAATCACGC. Internal left primer: GTCGTCGGTTTGCATTAGGT. Internal right primer: ACGTGGGAGACCAATCTGAC. Internal WT amplicon: 2730 bp. Deletion size: 1252 bp. Deletion left flank: AGCTTCTGGAGCATTGGCGGCATTTGTTCG. Deletion right flank: TTCCTACTTTTCCCAGCCAAATCGCTTGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B2.4. External left primer: TGCAATACCCCAAATTGGTT. External right primer: AGTTTGGTTGAGATCGTCCG. Internal left primer: TTATTGACGGTTCCTCGGTC. Internal right primer: GCTGATCGCCCATATCTCAT. Internal WT amplicon: 1963 bp. Deletion size: 834 bp. Deletion left flank: TTAAACTAATATTTGCGGTAAAATATGTAC. Deletion right flank: CCAAAAAAAAAAACTGTTCCCCATGGAAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F38A5.13. External left primer: ATCCAACTCGGCATCATCTC. External right primer: AATGCAAATCCGCTCAATTC. Internal left primer: TGAAGTCGAATCTGCGAGTG. Internal right primer: GCGAGTTTCTTCAGACGCTT. Internal WT amplicon: 2118 bp. Deletion size: 563 bp. Deletion left flank: ATGGTCCAATATCAAGCCAGTGCCAGAACT. Deletion right flank: GCGTAAGCGTCTGAAGAAACTCGCTGATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26D12.1. External left primer: CGGAGGAGGGAGTAAAGGAC. External right primer: CTTGAAGCCTACTCCGTTCG. Internal left primer: AAACAACCAACCAGCCAAAC. Internal right primer: TTAGAAACAGCAGCCGTCAA. Internal WT amplicon: 2256 bp. Deletion size: 952 bp. Deletion left flank: AGGTCCTTTCGAAGGACTACCTTTATATTC. Deletion right flank: TTCTTCCGGAAACTCCGCCCATAAATGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C48A7.2. Apparent homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2116 homozygotes (arrest stage/phenotype undetermined). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTACGCCGGAAAGACAAAAA. External right primer: AAATCAATGAATGTGGGGGA. Internal left primer: TAAATGACGCCGAATTGTCA. Internal right primer: ATCGAAACTGCGCTGATCTT. Internal WT amplicon: 3253 bp. Deletion size: 1307 bp. Deletion left flank: TTGTTACAATAACTATGCAAATGTAAATAT. Deletion right flank: CCCCAAGATATAGTTTCGATAAGTAAATAC. Insertion Sequence: AT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F58B3.3. External left primer: TTGTTTGATTGCACGTGGTT. External right primer: GATCGTGGTGTGGTTCACAG. Internal left primer: TTGGCTTCCAAACCATTTTC. Internal right primer: ATCAATGCCTCTGGATCGAC. Internal WT amplicon: 2135 bp. Deletion size: 1265 bp. Deletion left flank: GAGAACGCTTTCGTGAATCGGGATTTAAAA. Deletion right flank: TTTAGGCAAGGGAAGATGTATCCATCGACA. Insertion Sequence: GGCAAGGGAAGAAGAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F47C12.1. External left primer: ATGTTCGCAACGGAAAAATC. External right primer: GCAGAGCATGCAAGTGTTGT. Internal left primer: ATGAGGACAACATCGCAACA. Internal right primer: CTCTGGAAGTCGATCCTTCG. Internal WT amplicon: 3320 bp. Deletion size: 2317 bp. Deletion left flank: CTTCTAAATCCGATGGGCTCACCGTAACTC. Deletion right flank: GACTGCTGGATGTCCTAGCATAACCGCCAA. Insertion Sequence: GATGTGGGTGTGGGTATTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08C7.5. External left primer: TGTTCAATGATCGTACCCGA. External right primer: GTTCGAAATTGGGAAATCCA. Internal left primer: CGTGATCAGAGACGACCAAA. Internal right primer: AATGGTCGTTTTACCGCATC. Internal WT amplicon: 2216 bp. Deletion size: 1070 bp. Deletion left flank: GAGAAGAAAAAACGTTGGAAGAAATCTTTG. Deletion right flank: AACGGTGCCAGAAATGCGATTTTGACTATT. Insertion Sequence: GA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y102A5C.18. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk790 homozygotes (sterile, no eggs). Homozygous nT1[qIs51] inviable. NOTE: Balancer is prone to breaking down. Pick WT GFP+ and check for correct segregation of progeny to maintain. External left primer: TGTCGTTTCCCTTCCTTCAC. External right primer: TAGGCACAGCTTGAACCCTT. Internal left primer: TGGAGCGAAATTGAGGCTAT. Internal right primer: CAGAAAGCTAAGACCTGCGG. Internal WT amplicon: 1986 bp. Deletion size: 671 bp. Deletion left flank: GTGTCAAAAATGAAATTTTCATATGAAAAT. Deletion right flank: CAAAGTCAAGCTCATTGTCGAGCCCGAGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13H10.4. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2135 homozygotes (sterile, oftein with abnormal vulva). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGCATGGACTTGAGGATTGG. External right primer: AATGGTGCCATCTATCAGGC. Internal left primer: TGAGCATCATTGGGAACAAA. Internal right primer: ATAACTCAAAAAGCGCCGAA. Internal WT amplicon: 3344 bp. Deletion size: 1311 bp. Deletion left flank: TTGTATCTGTAATAAAATCGAAAAAGTAAT. Deletion right flank: GAGCATTACAGAATGAGAAGTTTGAAGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F56A12.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk798 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGGAAATCATCATCCAAT. External right primer: CAGACAAGGATAGCACGCAA. Internal left primer: CCCATCCTCACCTCCTAACA. Internal right primer: TTTACGACTTGGCAGCTGGT. Internal WT amplicon: 2117 bp. Deletion size: 1032 bp. Deletion left flank: CGAGGGAAATCAAATATCAGAACTTGAAAA. Deletion right flank: TATCATTCCAATGAATTCGAGACACTCTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y51H4A.18. External left primer: TATCGATGGGGATCAAGAGC. External right primer: TGCCTTTTTATATCAGCGCC. Internal left primer: GTAAATGGCAAATCAAGCCC. Internal right primer: CCAGGGTTCAACCAAACATC. Internal WT amplicon: 2021 bp. Deletion size: 265 bp. Deletion left flank: CCAAGGCAGATTTGTGAATGAACTCGGCGA. Deletion right flank: ATTAAAAATGTTTACTTTACTTATTTTATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y51H4A.12 & Y51H4A.15. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2136 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AATCCATTCCACCAATTCCA. External right primer: TTGAAAAATCGGCTTTCAGG. Internal left primer: ACTCCACTTGATTTCCACCG. Internal right primer: AAATTCCTCGCTTTTCGTCA. Internal WT amplicon: 2473 bp. Deletion size: 1621 bp. Deletion left flank: CTTCTGTCGGGAGAATGATTCGGTCCGCGG. Deletion right flank: CAAATATCCTGTATCACGATTTCGACCTGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25B3.1. Homozygous lethal/sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2140 homozygotes (late larval or sterile adult arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGGCAGCTGACTGATACA. External right primer: AACTTCTCACCCGTTGGATG. Internal left primer: AACCTACCGAGAGCGTGAGA. Internal right primer: GCTTTCCGTGAATTTGGTGT. Internal WT amplicon: 3312 bp. Deletion size: 1369 bp. Deletion left flank: AGGAACATCGAAAATCGAAAAAAAAATTCG. Deletion right flank: TACATAACTGAACATTTCCTACTACCATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F56A12.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2137 homozygotes (probably most often early larval or embryonic arrest, but occasional homozygotes are seen that are Dpyish, Unc and arrest as mid-stage larvae). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCGGAAATCATCATCCAAT. External right primer: CAAAAGTCACGCGAATCTCA. Internal left primer: CCCATCCTCACCTCCTAACA. Internal right primer: GCGAAGGAGATTTTGAGCAC. Internal WT amplicon: 3042 bp. Deletion size: 1782 bp. Deletion left flank: TTTTTAAAAACATGTTCAACATGCACATAG. Deletion right flank: GTTTTTTGAAACACTGAAAAAATAAAAACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T22D1.9. Apparent homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2259 homozygotes (arrest stage/phenotype undetermined). Viable WT non-GFP segregants are not homozygotes but rare recombinants. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTTGACCAACACGAACAGA. External right primer: TGACTGCGCCTTTAAACAAA. Internal left primer: TCAAGCTTCCAGGCTTCATT. Internal right primer: TGGTGGCGACTACTCAACAG. Internal WT amplicon: 2938 bp. Deletion size: 1651 bp. Deletion left flank: TATGAACAAGGGAATAGCCAAAACTCGAGG. Deletion right flank: ATGGCTTGTAAAGTGTTCAATTTCAGGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk828) in ZK185.2, detectable by PCR using the following primers. External left primer: AACCAAACGATGTCCCTGAC. External right primer: TCGGAAATGAAAACCCCATA. Internal left primer: TATTAGAGGCATATCGGCGG. Internal right primer: ATCACACCGGCGAGAATTAG. Internal WT amplicon: 1842 bp. Deletion size: 1014 bp. Deletion left flank: TTAAAGAATAAATATTTCATTTGGAAGCTC. Deletion right flank: AGGGGCGCGTTAAGAAATCTTGGGTCTTTA. Validation: No CGH probes for gk828. Other deletion (gk3130) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C53D6.3. External left primer: CGCTCGCCACTTCTTTTAAC. External right primer: ACGAAATCGACATCCACCTC. Internal left primer: TCTCTCACTTCCGCTGACCT. Internal right primer: TTCTTTCAACCAAACGGGTC. Internal WT amplicon: 2756 bp. Deletion size: 1749 bp. Deletion left flank: ATTCTCTTTTTAATTTGACAATCAACAATT. Deletion right flank: AATGTAAGTGTAATAGAATTTCAGAATTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y41D4B.20. External left primer: TCTCGTTGCTTCCAAGTGTG. External right primer: AGGTGGCTATTTCGCATGTC. Internal left primer: TGTTGGACGATATGGAGCTG. Internal right primer: CAGCCAATTTCCGAGGTAGA. Internal WT amplicon: 2357 bp. Deletion size: 1043 bp. Deletion left flank: TTTCTTTGTACAAAAACCATCACCAGCCTC. Deletion right flank: GAAATTTTGAACATCGAACCAACTATCCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y51H4A.18. External left primer: TATCGATGGGGATCAAGAGC. External right primer: TGCCTTTTTATATCAGCGCC. Internal left primer: GTAAATGGCAAATCAAGCCC. Internal right primer: CCAGGGTTCAACCAAACATC. Internal WT amplicon: 2021 bp. Deletion size: 435 bp. Deletion left flank: CTTAAAGTATACGTCGATTCTGAAAATACACTGAAAATGAAAT. Deletion right flank: TACAGGTTGGTACTTCTACTATGAAAAAAT. Insertion Sequence: TTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F12F6.7. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2252 homozygotes (sterile Unc). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTGCCACTTCAGGGAAAG. External right primer: AGACAAGGCTGGTCCTGCTA. Internal left primer: GGCAAACAACAAGGCAATTT. Internal right primer: GATCACGCCAAAGCAAATCT. Internal WT amplicon: 3379 bp. Deletion size: 1510 bp. Deletion left flank: TAGGGTGTTCGTTTTTCGATTTTTTTTTTA. Deletion right flank: ATTTCATTCAGAAGTCCGGGATTAAGTGGA. Insertion Sequence: TTATGCCATTTGAAAGAGCATTTTTTAAATGTTTTTCGATTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E04A4.8. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2256 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTCCGTAATTTGTTCGCGTT. External right primer: GATTGCTGATAACCCGTCGT. Internal left primer: GTTCCGATTTCTTGGTGCAT. Internal right primer: GAAACATGTGCAAGAGCCATT. Internal WT amplicon: 2463 bp. Deletion size: 1213 bp. Deletion left flank: TAAGAATTAATTTACCTTATCGAAATAGTG. Deletion right flank: TTCTATTACCGTATCCTTCATACACTCGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y94H6A.1. External left primer: TTGTCGGAGAGAAGAGGCAT. External right primer: TCTCGTCGAAATATCCCACC. Internal left primer: CGATTCTGACCCGAAGTGTT. Internal right primer: CTTCCTTCTTCACAATCGGC. Internal WT amplicon: 2016 bp. Deletion size: 1145 bp. Deletion left flank: ATCTCTTTCCACTTTTTTCAGTTCATTATT. Deletion right flank: GTGTGTGGCAACGCTGGTGCCACGTCACAC. Insertion Sequence: GT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T01B11.3, T01B11.4. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] IV. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Heterozygotes are WT with dim GFP signal in pharynx, and segregate WT with dim GFP, WT with brighter GFP (mIs11 homozygotes), and non-GFP sterile ok372 homozygotes. Pick dim GFP+ WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y73B6BL.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2308 homozygotes (mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTCCGAGAAGAGTACGCAGC. External right primer: GCATAAAAATTCCTGCCTGC. Internal left primer: CGGAATCCGAAAATGCATAC. Internal right primer: AGCTTTCCCCCGATTGTACT. Internal WT amplicon: 3151 bp. Deletion size: 1058 bp. Deletion left flank: GAAAATAAATTGAAAAATAATTTTTCAGGG. Deletion right flank: TAACAAGTTATAGCCGCAATGAATTTTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T19E7.2. Homozygous viable/sickly deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2315 homozygotes (viable, sickly, some eggs don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAAACCGACGTAATGTGGA. External right primer: TTTCACCTCCCACCGTCTAC. Internal left primer: CTCAACTGGGCATCTTCACA. Internal right primer: TTTCAGCCATCTCTCCTCGT. Internal WT amplicon: 2440 bp. Deletion size: 1103 bp. Deletion left flank: TTTTTGTATGTAAATTGCCAATGCCATAAT. Deletion right flank: CTCATAGGGTCGAGAGAAAATGAGAGAGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T28F3.1, M01D1.1. The allele gk1230 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: CATGGTCAACGAAGCTGAGA. External right primer: GAGAGGCAGAACCGAAGTTG. Internal left primer: TGCGACGAGATCTTGAAGTG. Internal right primer: AAAGCACATTTGGGCAAGAC. Internal WT amplicon: 2703 bp. Deletion size: 1246 bp. Deletion left flank: TTATTCTCTTTTCCCCCAAATCCCCTATAT. Deletion right flank: GGCAAATGGATAGCACGGATCTGAAATTAA. The allele gk3036 was identified by CGH but not confirmed by PCR. Left flanking probe: CTTGTTGCCCATCTCTGATTTACAACTCGGCCCATAGCGTAATTAAAAAT. Right flanking probe: GATATCCCTTCGAGAATAATATCAAAGTTAAATGTATCTTCATGTCGTTG. Left deleted probe: CACTCCAATTTTCCACGAAAATGCTTTGGCTGCATATCATACAATATTCT. Right deleted probe: ACTACCAGTTCACGTGCAGTTTGAGTTTGTTTCATCAAACCCATTAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk804) in ZK185.2, detectable by PCR using the following primers. External left primer: AACCAAACGATGTCCCTGAC. External right primer: TCGGAAATGAAAACCCCATA. Internal left primer: TATTAGAGGCATATCGGCGG. Internal right primer: ATCACACCGGCGAGAATTAG. Internal WT amplicon: 1842 bp. Deletion size: 780 bp. Deletion left flank: ACTTGAATTTTTCCAGTAATTTTAGTTTTG. Deletion right flank: CTCTACCGGAGTTTGAAGGCACTTATTCGT. Validation: No CGH probes for gk804. Other deletion (gk3143) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C01F6.6. External left primer: AATACATCGTTTTCCACGGG. External right primer: GTTAAGGCTCATCTCGTGCC. Internal left primer: CCCAATGTTTCGTCTTTTGG. Internal right primer: AATTTTGTTTTGGAAACAGTGAA. Internal WT amplicon: 3139 bp. Deletion size: 1117 bp. Deletion left flank: GAAATGCAATAATATTCAACAATTATATAT. Deletion right flank: GTAGACGACTATTTAATATTTAAAACTCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y51H4A.18. External left primer: TATCGATGGGGATCAAGAGC. External right primer: TGCCTTTTTATATCAGCGCC. Internal left primer: GTAAATGGCAAATCAAGCCC. Internal right primer: CCAGGGTTCAACCAAACATC. Internal WT amplicon: 2021 bp. Deletion size: 472 bp. Deletion left flank: AGTCATTGCACAGCTGGAACAGCAACAGAGACTAGAAAAT. Deletion right flank: ATGATTTTTTCTTGGCTTAAACGATAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y41D4B.20. External left primer: TCTCGTTGCTTCCAAGTGTG. External right primer: AGGTGGCTATTTCGCATGTC. Internal left primer: TGTTGGACGATATGGAGCTG. Internal right primer: CAGCCAATTTCCGAGGTAGA. Internal WT amplicon: 2357 bp. Deletion size: 879 bp. Deletion left flank: TCCAGCCCCGAGAAAGCCTAAACTTAAGTA. Deletion right flank: TTTTTTGGGTATGTTCTTTTTGGACCCCCATAACTTTTTTGAGAACAAGTTTCAGATAA TTTTTTTTCGATGAAATTTTAGTCAAATACTTGATTAACATTATCTCCATAAAAAATCA TATTAATAGCTCGTTGGCGCCGTGGGCTGGAACGCGAAAAAAACTTCCCATAATTAATT GTCACCCTGTATATGTATATATGTAATCATATGCACGTATATGTATAATTGATATGTAA TAGATATGTATAACCTATATGTATATAGTAATACATATGTTCAAAACCTAGTAGTATTA TATAAACCTAGTATAGAATATTACCATAACTAGTACCTACCTATGTATATGTATAAAAT ATGATGCCATGATCAGACTGAATGGTAGGTTAATCATCAATCAAAAAATTACTTCAAAA TAATACCCCGGTTTCAGTTATACACCATAACGCCGAATTCAGTAAGCCTATTGTTGGTT TTCGGTAGTTAGTGAATAAACTTATTATTATTATTATTATTATTTGGGTGTATATCTTA TATCATACTATTTTATACATGTTCTTATTAAGGAAAAGGTTTATTTCGTTGCACCTCTG ATTACGGCTCAAAAACCTACCTGTAAATTCGGTAGGATTGACAATATATCCCCTAGTCG AATTGACGAATCTAATTCTGATCTCGTCAGCTTGGAGTACTGTAGAACTTCCCGCTGCA CGGATTCCCGAATCCTTCTGCATGATTCTGTGCATTGATCGGACTGGCCTTCTAGCCCC GTGTCGAATAGAGTTAAGGCTGTTAGAGCCAGAAATTCGAATTTGTCACACGCAATTCG GATCATTGGATCGTACACATTGCGGCGGTAAGTGTCGAATGAGCTGGCGAACATTCTGG AAAATTTTTTAAATCGGCAAAGATATTTGAATAGATTCCTACTTGGAAGCTTCTACCTC GGAAATTGGCTGTTGTCCATCTGGATCGTGATAATACGTTTCTGGATTCACACAATCAA TATAATCACCAGATGGTAGGTAGGTAATGTCTGTTCTGCCATATTGACATGCGAAATAG CCACCTTCGAGGATGATGAATTGTAGGTAGAAGTTGTGGAGCAGGGTTGTCTGAAAGAA TTCGAGGTATGGACTTTGGACAGGGTAAGCATTCTTGGACAGACTCTAAGCAGGCTTTT GCCAAATAACGAGCAGAACTTTACTCGACCAGGCTGGGAAAGATTTGGACCAGAATTGG TCCTGATATTGTTCAACTCTTCGCTTGGCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y51H4A.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2418 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGGGAGAGGAGATGTGTGAT. External right primer: GCAAATCCAGGTTTTTCCCT. Internal left primer: ATTGGAATAGAGAAGCGCGA. Internal right primer: TTTTCACCCGAAAATCCAGA. Internal WT amplicon: 3317 bp. Deletion size: 2091 bp. Deletion left flank: ATTTGGGGGAAAATTAGATGAACTTTTGTT. Deletion right flank: AAAAAACTTAAATTTTCAGCAAAAATTGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZC416.8b. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2253 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGACTGACACGCCAATTTTT. External right primer: TGCAATGGCCAAAATGACTA. Internal left primer: CGAGCTCATCGAAAACTTCC. Internal right primer: CCCAAGCCTAAGCCTAAACC. Internal WT amplicon: 2862 bp. Deletion size: 1712 bp. Deletion left flank: ACCGTATATCTACAGTACCCCTACATCACT. Deletion right flank: TGCAAAATATTTCTGTGAGAGGTAATTTAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K04A8.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk857 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCATTTGTTGAGCCTGCTG. External right primer: ACGCTGAGAGTAAGTGCGGT. Internal left primer: TCAGTGAATGTCAATGCGGT. Internal right primer: CCCGATCATTCTCAACCATT. Internal WT amplicon: 2234 bp. Deletion size: 1021 bp. Deletion left flank: TGAAAACACTTTGAGAAGAAGTTCTTCGGG. Deletion right flank: TAGATGGTGGCAGATTCCGAATAGCTGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y67D8B.2. External left primer: GGAAAAGCAGACAACCTTGC. External right primer: AAGCCTGCCTAACGACTTGA. Internal left primer: GAGATTCCAGCAAGCCACTC. Internal right primer: GGGTGCCACTAATCGCTAAA. Internal WT amplicon: 1761 bp. Deletion size: 485 bp. Deletion left flank: CATTTGGGTCGAGGCTACTGGATTCATCTG. Deletion right flank: CCTATATGCCTACGTGTTAGGTCGGATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F17C11.9. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2464 homozygotes (sterile Dpy). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AAGCTCGCCAACAAGACTGT. External right primer: TCCGAAAAGAATCATGGAGG. Internal left primer: ATTTCAGACCCCAGCATTTG. Internal right primer: TACAGCTCATGAAGGCGAGA. Internal WT amplicon: 1152 bp. Deletion size: 357 bp. Deletion left flank: AACGTTTTTCATGGGACTGAGAGTTGGAAA. Deletion right flank: ACCAAGGCTATCCCACACTTCTGGGAGAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y43C5A.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2218 homozygotes (sterile, lays eggs that don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTTACCTCATTCTTGGCCG. External right primer: GTTCCTATCGGTGCCTTTCA. Internal left primer: TGAATCCGTGAAAGTGTGGA. Internal right primer: AGGACTTGGCACGTGTCTCT. Internal WT amplicon: 2435 bp. Deletion size: 1634 bp. Deletion left flank: AACGAACGGCTAGTCCTCGCGTGCGTCCTC. Deletion right flank: TGATACTTTCAATTCAATTAATTGGATTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y2H9A.1. Homozygous maternal effect sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2326 homozygotes (maternal effect sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGTTCTTGCGGTTTTTCGTG. External right primer: TTCCAGCTACCTTCACCCAC. Internal left primer: GGTGTCGGCTACAGGTTGAT. Internal right primer: GCCACGAAAGTTTCTGAGTG. Internal WT amplicon: 3258 bp. Deletion size: 1596 bp. Deletion left flank: TCTGAAAATGACAATTGGCAAAATATAAAA. Deletion right flank: AAATTATCATTTCGAACTTCTCCACTTTCC. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y55F3BL.2. External left primer: TTTCACCCAATTTTCAAGCC. External right primer: GCTCACGGAATCTGTGTTCA. Internal left primer: CGAAGTGAGACGTTTAGGGC. Internal right primer: ATTCAATCGAATTTCGTGCC. Internal WT amplicon: 2938 bp. Deletion size: 1401 bp. Deletion left flank: ACGGGTCATAAAGCGAAAACGCGGAGGGTT. Deletion right flank: GATACATATGATGCTTAGATGTTGAAATTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807