More Fields
Strain Species Genotype
VC2192 C. elegans lpr-2(ok2915) IV. Show Description
T12A7.5. External left primer: GAAAATATTCGGCCTGCAAA. External right primer: GCACCAGTAGAGAACGGCTC. Internal left primer: CGAGTGCTAACTGTGGTTGC. Internal right primer: GGAATTTGACTGGAAAAGGG. Internal WT amplicon: 1155 bp. Deletion size: 436 bp. Deletion left flank: ATCTATCGAGAACTTCAAAAAGTTTGTGTG. Deletion right flank: TTTTTCAACAAGAATTTATCTTAAACTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3370 C. elegans clpr-2(ve870[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 956 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAATGGAGAATGGAAAGTGATTAAAATTGA ; Right flanking sequence: CGGAACAATTGAGAAATAGGGTGAATTTGT. clpr-2 sgRNA #1: TTTTCACGTTCCAAGCTCGT; clpr-2 sgRNA #2: AGAAGCGCTAAGATTAGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.