More Fields
Strain Species Genotype
RB1312 C. elegans C54E4.2(ok1428) IV. Show Description
C54E4.2 Homozygous. Outer Left Sequence: aaaatgcccacttgcgatac. Outer Right Sequence: gggggaaaactgtttccatt. Inner Left Sequence: aatgcgaatttctttggacg. Inner Right Sequence: aatgcaacaaaccaccaaca. Inner Primer PCR Length: 2878. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2181 C. elegans C54E4.2(gk1083) IV; alh-2(gk3053) V. Show Description
K04F1.15, C54E4.2. The allele gk1083 was identified by PCR, validated by CGH, and can be detected using the following PCR primers. External left primer: TTTTTGACGACCAACCAACA. External right primer: CGAGGCTCTTTACGCAATTC. Internal left primer: CGCAGCGAACAAAGTTATGA. Internal right primer: CGTGGCGAGACCTATAAAGC. Internal WT amplicon: 1288 bp. Deletion size: 575 bp. Deletion left flank: TGAATACCGTTAATTTTTTTTTTTTAATTA. Deletion right flank: TTCGCTGAAAAATATAATTTCTTTCTGGTG. The allele gk3053 was identified by CGH and not confirmed by PCR. Left flanking probe: ATTTTACATTAGTCCGTGAATTTCAGATACTACGCCGGATATGCTGATAA. Right flanking probe: GCGCGGGATCAGTTTGGGTCAACTGTTATGATGTTTTTGATCCTGCTGCT. Left deleted probe: TATGCTGATAAAAACCACGGAAAAACCATTCCCGTCGGTGGAGACTATTT. Right deleted probe: TGAATAAAGCTCTTCAAGTCGCAAATACTATCCGCGCGGGATCAGTTTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2213 C. elegans C54E4.2(gk1003) IV. Show Description
C54E4.2. External left primer: TTTTTGACGACCAACCAACA. External right primer: CGAGGCTCTTTACGCAATTC. Internal left primer: CGCAGCGAACAAAGTTATGA. Internal right primer: CGTGGCGAGACCTATAAAGC. Internal WT amplicon: 1288 bp. Deletion size: 469 bp. Deletion left flank: TTTTTTTTTTTGGAGCTTCAGTTGAAGTTG. Deletion right flank: AGTCTCAGGAATGCAATTATAATTAGATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807