More Fields
Strain Species Genotype
VC2181 C. elegans C54E4.2(gk1083) IV; alh-2(gk3053) V. Show Description
K04F1.15, C54E4.2. The allele gk1083 was identified by PCR, validated by CGH, and can be detected using the following PCR primers. External left primer: TTTTTGACGACCAACCAACA. External right primer: CGAGGCTCTTTACGCAATTC. Internal left primer: CGCAGCGAACAAAGTTATGA. Internal right primer: CGTGGCGAGACCTATAAAGC. Internal WT amplicon: 1288 bp. Deletion size: 575 bp. Deletion left flank: TGAATACCGTTAATTTTTTTTTTTTAATTA. Deletion right flank: TTCGCTGAAAAATATAATTTCTTTCTGGTG. The allele gk3053 was identified by CGH and not confirmed by PCR. Left flanking probe: ATTTTACATTAGTCCGTGAATTTCAGATACTACGCCGGATATGCTGATAA. Right flanking probe: GCGCGGGATCAGTTTGGGTCAACTGTTATGATGTTTTTGATCCTGCTGCT. Left deleted probe: TATGCTGATAAAAACCACGGAAAAACCATTCCCGTCGGTGGAGACTATTT. Right deleted probe: TGAATAAAGCTCTTCAAGTCGCAAATACTATCCGCGCGGGATCAGTTTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
CGC1 C. elegans C. elegans wild isolate. Show Description
CGC1 (formerly known as PD1074) is intended to be used as a wild-type reference strain with the closely matched genome assembly of Yoshimura, et al. (Genome Res. 2019 Jun;29(6):1009-1022) available on Wormbase as VC2010-1.0. (ENA study accession PRJEB28388; assembly accession GCA_900538205). CGC1 is a defined and recently cloned population of animals derived from the original "Bristol" variant of C. elegans originally obtained by Brenner from E. Dougherty with no known history of mutagenesis. Brenner's original population, called N2, was used as the basis for the vast majority of laboratory strains in use currently. No early frozen stock of the unmutagenized N2 population currently exists, but later stocks were available from several laboratories. CGC1 is a clonal population founded by picking a single worm of one such stock, VC3510. VC3510 in turn derives from a subpopulation of N2 described in the literature as VC2010. We note that CGC1 is expected to be largely similar to most lab N2 strains, but that as a clonal isolate derived from N2, there will be some loci that will vary compared to any other particular N2 isolate. One such example is a partial deletion of the alh-2 locus in CGC1. Additional loci that were found to vary between the prior N2 reference genome (WormBase release WS264) and the VC2010-1.0 assembly are detailed in supplemental table 8 in Yoshimura, et al, (2019).
N2 C. elegans C. elegans wild isolate. Show Description
C. elegans var Bristol. Generation time is about 3 days. Brood size is about 350. Also CGC reference 257. Isolated from mushroom compost near Bristol, England by L.N. Staniland. Cultured by W.L. Nicholas, identified to genus by Gunther Osche and species by Victor Nigon; subsequently cultured by C.E. Dougherty. Given to Sydney Brenner ca. 1966. Subcultured by Don Riddle in 1973. Caenorhabditis elegans wild isolate. DR subclone of CB original (Tc1 pattern I). [NOTE: This stock might carry a ~1.8 kb deletion in alh-2 in the background. (UPDATE: 03/26/2018 - a user reported the stock they received was homozygous for the alh-2(ot588) mutation.)]
N2 Male C. elegans C. elegans wild isolate. Show Description
C. elegans var Bristol. Self-fertilizing hermaphrodite. Generation time is about 3.5 days at 20C. Male stock maintained by mating. Also CGC reference 257. Isolated from mushroom compost near Bristol, England by L.N. Staniland. Cultured by W.L. Nicholas, identified to genus by Gunther Osche and species by Victor Nigon; subsequently cultured by C.E. Dougherty. Given to Sydney Brenner ca. 1966. Subcultured by Don Riddle in 1973. Caenorhabditis elegans wild isolate. DR subclone of CB original (Tc1 pattern I). [NOTE: (09/07/2018) The Gems Lab has identified a mutation in the gene fln-2 carried in this stock causing an increased lifespan. The effect is quite modest (+11%, median lifespan), but this effect can be more pronounced in other genetic backgrounds.] [NOTE: (03/26/2018) - a user reported the stock they received was homozygous wild-type for alh-2; some N2 stocks carry the ot588 mutation in alh-2.)