Strain Information

Name GOU2382   View On Wormbase
Species C. elegans
Genotypeche-3(cas527[gfp::che-3(delta_V828-L984)]) I.
DescriptionGFP inserted into the endogenous che-3 locuse at its N-terminus and 659 bp in-frame deletion introduced by Cas9-triggered genome editing. Deletion left flank: TTGGTTAGTGATATCTCAAG; deletion right flank: ATGGGCATCAATCAATGAT. Weak green fluorescence in the cell bodies of ciliated neurons but not in the amphid or phasmid cilia. Lipophilic dye filling is 100% defective.
MutagenGFP inserted into the endogenous che-3
Outcrossedx3
Made byPeishan Yi
Laboratory GOU
Reference Yi P, et al. Curr Biol. 2017 Apr 27. pii: S0960-9822(17)30424-4.
Sign in or register an account if you want to order this strain.