Strain Information
| Name | GOU2382 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | che-3(cas527[gfp::che-3(delta_V828-L984)]) I. |
| Description | GFP inserted into the endogenous che-3 locuse at its N-terminus and 659 bp in-frame deletion introduced by Cas9-triggered genome editing. Deletion left flank: TTGGTTAGTGATATCTCAAG; deletion right flank: ATGGGCATCAATCAATGAT. Weak green fluorescence in the cell bodies of ciliated neurons but not in the amphid or phasmid cilia. Lipophilic dye filling is 100% defective. |
| Mutagen | GFP inserted into the endogenous che-3 |
| Outcrossed | x3 |
| Made by | Peishan Yi |
| Laboratory | GOU |
| Reference | Yi P, et al. Curr Biol. 2017 Apr 27. pii: S0960-9822(17)30424-4. |
Sign in
or
register an account if you want to order this strain.