Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
CF4608 C. elegans muIs252 II; unc-119(ed3) III; his-3(mu500[his-3::wrmScarlet11(x3)]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11(x3) generated via CRISPR/Cas9 insertion of three wrmScarlet11 tags into the endogenous his-3 locus in parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4610 C. elegans muIs257 I. Show Description
muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Muscle-specific expression of wrmScarlet1-10 (Under the control of the myo-3 promoter and unc-54 3'UTR). Generated using CRISPR/Cas9 in the SKI-LODGE strain WBM1126. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249
CF4611 C. elegans muIs257 I; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4610. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
CF4614 C. elegans muIs252 II; tbb-2(muIs260[wrmScarlet11::tbb-2]) unc-119(ed3) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11 inserted at the N-terminus of the endogenous tbb-2 locus; detectable in all somatic tissues where wrmScarlet1-10 is present. Figure 3B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
CF4616 C. elegans muIs252 II; unc-119(ed3) III; vha-13(muIs264[wrmScarlet11(x2)::vha-13]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Two tandem repeats of split-wrmScarlet11 inserted at the N-terminus of the endogenous VHA-13 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure 4A from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
CF4625 C. elegans muIs252 II; unc-119(ed3) III; tomm-20(muIs276[tomm-20::wrmScarlet11(MDELYK)]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11(MDELYK) inserted at the C-terminus of the endogenous TOMM-20 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure S6B from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
CF4627 C. elegans muIs252 II; unc-119(ed3) III; his-3(muIs278[his-3::wrmScarlet11(MDELYK)]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. split-wrmScarlet11(MDELYK) inserted at the C-terminus of the endogenous HIS-3 locus; detectable in somatic tissues where wrmScarlet1-10 is present. Figure S6A from Goudeau et al., Genetics 2021. Reference: Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
CF4637 C. elegans Show Description
eat-6::wrmScarlet11_MDELYK split scarlet insertion in the genome with ubiquitous expression of wrmScarlet1-10
CGC19 C. elegans eT1 III; eT1 [umnIs8] V. Show Description
umnIs8 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] V. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain CB873 using CRISPR/Cas9.
CGC20 C. elegans dpy-18(e364)/eT1 III; unc-46(e177)/eT1[umnIs9] V. Show Description
umnIs9 [myo-2p::GFP + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-36 GFP+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC23 C. elegans dpy-18(e364)/eT1 [umnIs12] III; unc-46(e177)/eT1 V. Show Description
umnIs12 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] III. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Unc-36 GFP+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC34 C. elegans eT1 [umnIs12] III; eT1 V. Show Description
umnIs12 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] III. Derived by insertion of myo-2p::GFP transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC55 C. elegans eT1 [umnIs45] III; eT1 V. Show Description
umnIs45 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] III. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain CB873 using CRISPR/Cas9.
CGC60 C. elegans dpy-18(e364)/eT1 III; unc-46(e177)/eT1[umnIs46] V. Show Description
umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type mKate+, and segregate wild-type mKate2+, Unc-36 mKate+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC69 C. elegans dpy-18(e364)/eT1 [umnIs55] III; unc-46(e177)/eT1 V. Show Description
umnIs55 [myo-2p::mKate2 + NeoR, V:1005689 (intergenic)] III. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, Unc-36 mKate+(eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.
CGC70 C.elegans eT1 III; eT1 [umnIs56] V. Show Description
umnIs56 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] V. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain CB873 using CRISPR/Cas9.
DA1060 C. elegans +/eT1 III; adDf1059/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs.
DG769 C. elegans unc-32(e189) emb-30(tn476) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-32 Steriles and Unc-36.
DG783 C. elegans unc-32(e189) emb-30(tn478) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-32 Steriles and Unc-36.
DG784 C. elegans unc-32(e189) emb-30(tn477) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-32 maternal effect lethals (Mel) and Unc-36.
DG786 C. elegans unc-32(e189) emb-30(tn480) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-32 Steriles and Unc-36.
DG800 C. elegans unc-32(e189) tnDf2 III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Maintain by picking WT. tnDf2 is not transmitted well by males (i.e. tnDf2/+ males have a low mating efficiency).
DG832 C. elegans emb-30(tn475)/eT1 III; unc-46(e177) mdf-1(gk2)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-46 Steriles, and Unc-36 (eT1 homozygotes). Maintain by picking WT.
EL186 C. elegans dpy-19(e1259) ego-4(om30)/eT1 III; +/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Dpy (ts) Mel, Unc-36 and dead eggs. dpy-19 ego-4 progeny die as embryos.
EL187 C. elegans dpy-19(e1259) ego-5(om31)/eT1 III; +/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Dpy (ts) Mel, Unc-36 and dead eggs.
FX291 C. elegans +/eT1 III; spn-4(tm291)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. 1/3 of WT animals (spn-4 homozygotes) are Mels: segregate only dead embryos with have no morphogenesis. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
GC613 C. elegans eef-1A.1(ar229) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Steriles (homozygous ar229), Unc-36 (homozygous eT1), and dead eggs. ar229 have severely reduced germline proliferation.
GLW27 C. elegans muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26
GLW29 C. elegans muIs252 II; unc-119(ed3) III; egl-1(utx23[egl-1::wrmScarlet11::3xMyc]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of EGL-1 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous egl-1 locus. Genetic background: strain CF4582. Insertion verified by PCR, Sanger sequencing, and fluorescence. Left flank: 5' CAGAAGTCTCTTCCATCGTCTTCTGGACTTTTTCGCTTTT 3' (one silent mutation); Right flank: 5' TAAgtgatcaaaatctccaacttttctcca 3'; sgRNA: AGTCCAGAAGACGATGGAAG; Cas9/sgRNA plasmid: pGLOW65; wrmScarlet11^SEC^3xMyc plasmid: pGLOW66; SEC insertion allele strain: GLW28.
JIM220 C. elegans ujIs113 II; unc-30(ok613) IV; ceh-36(ok795) X; ujEx173. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
JK1129 C. elegans unc-32(e189) qDf2/eT1 III; +/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 and dead eggs. Do not distribute this strain; other labs should request it from the CGC.
JK1389 C. elegans mog-1(q223) unc-69(e587)/eT1 III; +/eT1 V. Show Description
Heterozygotes are wild-type and segregate wild-type, Unc-36 (eT1 homozygotes), homozygous Mog (Unc, weak coiler). Maintain by picking wild-type. Do not distribute this strain; other labs should request it from the CGC.
JK1505 C. elegans unc-32(e189) glp-1(e2072) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Sterile Unc coilers, Unc-36s (eT1 homozygotes) and dead eggs. Pick WT to maintain. Do not distribute this strain; other labs should request it from the CGC.
JK2533 C. elegans qC1 [dpy-19(e1259) glp-1(q339) qIs26] III/eT1 (III;V). Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Throws heterozygous Rollers and Unc eT1 homozygotes. qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. It was an integration of qEx233. Do not distribute this strain; other labs should request it directly from the CGC.
JK4619 C. elegans tra-1(q106) III/eT1[qIs60](III;V). Show Description
qIs60 [pes-10::GFP + gut specific promoter::GFP + myo-2::GFP]. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP males, and dead eggs (eT1 homozygotes). Pick wild-type GFP+ and check for proper segregation of progeny to maintain. Reference: Schedl T, et al. Genetics. 1989 Dec;123(4):755-69. doi: 10.1093/genetics/123.4.755. PMID: 2612895.
JK590 C. elegans glp-1(q35)/eT1 III; him-5(e1490)/eT1 V. Show Description
Heterozygotes are wild-type and segregate wild-type heterozygotes, glp-1(q35) homozygotes (Muv steriles), eT1 homozygotes (Unc-36), and males. glp-1(q35) has a semi-dominant multi-vulva phenotype as well as the loss-of-function Glp phenotype (sterility and embryonic lethality). The q35 mutation is a nonsense mutation that eliminates 122 C-terminal amino acids including a PEST sequence. The C terminus was thought to contain a negative regulatory domain that inactivates glp-1 in the VPCs; the inappropriate glp-1(q35) activity can substitute for lin-12 vulval fate determination. References: Austin J & Kimble J. Cell. 1987 Nov 20;51(4):589-99. Mango S, et al. Nature. 1991 Aug 29;352(6338):811-5.
JS71 C. elegans dpy-11(e224) air-1(vw5) V/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Dpy Stu, Unc-36 (eT1 homozygotes) and dead eggs. Also weak Him.
JS83 C. elegans air-1(vw5) V/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-36, Steriles (vw5 homozygotes) and dead eggs.
JT5132 C. elegans +/eT1 III; exp-2(sa26)/eT1 [let-?(n886)] V. Show Description
Heterozygotes have jerky movement, are Exp defective, and are Egl (dominant). Homozygous exp-2 are recessive lethal. Homozygous eT1 are lethal also.
MT10784 C. elegans dpy-18(e364) lis-1(n3334) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), and dpy-18 lis-1 homozygotes which are Mel, Unc, Egl, and Dpy.
MT12960 C. elegans epc-1(n4076) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Uncs, Ste/Mel, and dead eggs. The epc-1(n4076) deletion removes 886 nucleotides from the epc-1 locus (Y111B2A.11). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 2014 and ends at about nt. 2899 to give the junction sequence CTTCTCTGT/CCGGCTTTA.
MT12963 C. elegans ssl-1(n4077) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc, Ste/Mel, and dead eggs. ssl-1(n4077) deletion removes 683 nucleotides from the ssl-1 locus (Y111B2A.23). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 5075 and ends at about nt. 5757 to give the junction sequence GATATACAC/AGACCTAAT.
MT1965 C. elegans lin-12(n941)/eT1 III; him-5(e1467)/eT1 [him-5(e1467)] V. Show Description
Heterozygotes are WT and segregate WT, Muv or Steriles (homozygous n941), Unc-36 (homozygous eT1), and dead eggs. Pick wild-type and check for correct segregation of progeny to maintain. n941 is a lin-12 null allele. lin-12(n941) homozygotes are Muv or Ste. e1467 is also carried on eT1.
MT20112 C. elegans +/eT1 III; unc-46(e177) dpy-11(e224)/eT1 nIs267 V. Show Description
nIs267 [myo-2::GFP] integrated in or near eT1. Heterozygotes are wild-type and segregate WT, Dpy Unc, and Unc. Maintain by picking wild-type; check for presence of Unc progeny.
MT20113 C. elegans unc-32(e189) dpy-18(e499)/eT1 III; +/eT1 nIs267 V. Show Description
nIs267 [myo-2::GFP] integrated in or near eT1. Heterozygotes are wild-type and segregate WT, Dpy Unc, and Unc. Maintain by picking wild-type; check for presence of Unc progeny.
MT20114 C. elegans eT1 (III;V); nIs267 V. Show Description
nIs267 [myo-2::GFP] integrated in or near eT1. Unc.
MT2583 C. elegans dpy-11(e224) nDf32 V/eT1 (III;V). Show Description
Heterozygotes are WT (slightly Unc) and segregate WT, Unc-36 and dead eggs. Maintain by picking WT.
MT2590 C. elegans +/eT1 III; dpy-11(e224) unc-70(n493n1171)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), arrested larvae (n493n1171 homozygotes) and dead eggs.
MT2591 C. elegans +/eT1 III; dpy-11(e224) unc-70(n493n1172)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygotes), arrested larvae (n493n1172 homozygotes) and dead eggs.
MT2592 C. elegans +/eT1 III; dpy-11(e224) unc-70(n493n1173)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36 (eT1 homozygtes), arrested larvae (n493n1173 homozygotes) and dead eggs.