Search Strains

More Fields
Strain Species Genotype Add
VT3294 C. elegans maIs387 I; maIs391 II; mir-83(n4638) IV; mir-34(gk437) X. Show Description
maIs387 [mir-34p::mir-34 + Cbr-unc-119(+)] I. maIs391 [mir-83p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT333 C. elegans +/szT1 [lon-2(e678)] I; dpy-17(e164) III; dpy-6(e14) lin-14(n536) maDf2/szT1 X. Show Description
Heterozygotes are Dpy and segregate Dpy, males and dead eggs.
VT3500 C. elegans wIs51 V; hbl-1(ma354) X. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111.
VT3554 C. elegans nhl-2(ma371[gfp::3xFLAG::nhl-2]) III. Show Description
Endogenous nhl-2 locus tagged at the N-terminus with GFP and 3xFLAG. Reference: McJunkin K & Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437. PMID: 28279983
VT3593 C. elegans lin-46(ma385) maIs105 V. Show Description
maIs105 [col-19::GFP]. Retarded heterochronic phenotypes: extra seam cells and alae gaps in young adults. ma385 is a 1681 bp deletion of the lin-46 gene. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).
VT3650 C. elegans lin-46(ma398[lin-46::mCherry]) V. Show Description
mCherry reporter inserted into C-terminus of endogenous lin-46 locus. Superficially wild-type. Fluorescent signal is very dim and bleaches very quickly. Reference: Ilbay O, et al. C. elegans LIN-28 controls temporal cell-fate progression by regulating LIN-46 expression via the 5’UTR of lin-46 mRNA. bioRxiv 697490; doi: https://doi.org/10.1101/697490.
VT3727 C. elegans lin-28(ma426[lin-28::GFP]) I. Show Description
GFP reporter inserted into C-terminus of endogenous lin-28 locus. Superficially wild-type. Reference: Ilbay O, et al. C. elegans LIN-28 controls temporal cell-fate progression by regulating LIN-46 expression via the 5’UTR of lin-46 mRNA. bioRxiv 697490; doi: https://doi.org/10.1101/697490.
VT3855 C. elegans lin-46(ma467) maIs105 V. Show Description
maIs105 [col-19::GFP]. Precocious heterochronic phenotypes: fewer seam cells and protruding vulva in young adults and patches of alae in L4 larvae. ma467 is a 12 bp deletion in the 5'UTR of the lin-46 gene, which results in gain-of-function of lin-46. Reference: Ilbay O & Ambros V. Development. 2019 Nov 6;146(21).
VT3923 C. elegans maIs105 V; daf-12(ma498[daf-12::mScarlet-I]) X. Show Description
maIs105 [col-19p::GFP] V. mScarlet-I tag inserted at C-terminus of endogenous daf-12 locus through CRISPR/Cas9-engineering. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111.
VT454 C. elegans maDf4/dpy-10(e128) unc-104(e1265) II. Show Description
Heterozygotes are WT (slightly Dpy) and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.
VT509 C. elegans lin-4(e912) II; maEx114. Show Description
maEx114 [lin-4(+) + rol-6(su1006)]. Pick Rollers to maintain. lin-4 loss-of-function is rescued by the maEx114 extrachromosomal array expressing lin-4 microRNA. Reference: Lee RC, et al. Cell. 75, 843-854.
VT516 C. elegans lin-29(n546)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are slightly shorter than WT and segregate DpyUnc and Egl.
VT573 C. elegans lin-4(e912) II; lin-14(n179) X. Show Description
lin-14(n179) is temperature-sensitive. lin-4; lin-14 double mutant may be maintained at 20C.
VT581 C. elegans dpy-5(e61) lin-28(n719) I; lin-46(ma164) unc-76(e911) V. Show Description
Dpy Unc. Egl+. lin-46 suppresses precocious Egl- phenotype of lin-28. lin-46 alone makes gaps in adult alae; enhanced at 15C.
VT592 C. elegans lin-28(n719) lin-10(n1390) I. Show Description
Vul.
VT664 C. elegans lin-28(n719) I; nIs2 IV. Show Description
nIs2 [lin-11::lacZ + lin-11(+)] IV. Egl. Integrated on IV near dpy-20.
VT723 C. elegans lin-28(n719) I; lin-3(e1417) IV. Show Description
Egl. Vulvaless due to lin-3. Precocious VPC divisions and adult alae due to lin-28.
VT733 C. remanei ssp. vulgaris Show Description
Male-female strain. Reference WBG 11(4):89. See also WBPaper00001874. May crawl off the plates. Isolated by Bill Fixsen at a rest area on the turnpike in Conn. Previously called WS9-6 and C. vulgaris NH and C. vulgariensis by the CGC. Walter Sudhaus has tentatively described this strain as C. remanei ssp. vulgaris; this description is not official and is contigent upon its being published. See WBPaper00002633.
VT757 C. elegans lin-28(n719) I; lin-12(n137n460) III. Show Description
Only gives a decent brood size at 20C. At 15C: Muv/Blip. At 20C: some Muv/Blip, some Blip but not Muv. At 25C: Not Muv, but do have Blip (due to lin-12). Egl- at all temps.
VT765 C. elegans unc-36(e251) III; maIs103. Show Description
maIs103 [rnr::GFP + unc-36(+)].
VT774 C. elegans unc-36(e251) III; maIs103. Show Description
maIs103[rnr::GFP + unc-36(+)]. Non-Unc. nrn::GFP is expressed in S phase cells.
VT825 C. elegans dpy-20(e1282) IV; maIs113. Show Description
maIs113 [cki-1::GFP + dpy-20(+)]. Non-Dpy. cki-1::GFP is expressed in all arresting cells that have exited cell cycle.
VT847 C. briggsae Show Description
C. briggsae wild type strain collected in Hawaii.
VV207 C. elegans ser-7(vq2) X. Show Description
CRISPR/Cas9-engineered knockout of ser-7. Resistant to exogenous serotonin induced food intake. Reference: Perez-Gomez A., et al. Nat Commun. 2018 Dec 10;9(1):5272.
VV212 C. elegans ser-5(vq1) I. Show Description
CRISPR/Cas9-engineered knockout of ser-5. Resistant to antipsychotic induced food intake. Reference: Perez-Gomez A., et al. Nat Commun. 2018 Dec 10;9(1):5272.
VX80 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H2. Isolated from pill bug in Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX81 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H3. Isolated from pill bug in Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX82 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H4. Isolated from pill bug in a Chinese cabbage field, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX83 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H5. Isolated from pill bug under roadside haystack, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX84 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H6. Isolated from pill bug under rotten grass, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX85 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H7. Isolated from soil under rotten grass, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX86 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H8. Isolated from pill bug in a vegetable field, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX87 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H9. Isolated from soil in an eggplant field, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VX88 C. latens Show Description
Caenorhabditis sp. 23 Male-female strain. Caenorhabditis elegans wild isolate. H10. Isolated from soil near the lotus pond, Juifeng Village, Wuhan City, Hubei Province. Lat: 30°30'51"; Lon: 114°29'42".
VZ1 C. elegans trx-1(ok1449) II. Show Description
B0228.5 Homozygous. Exhibits slightly shortened lifespan compared to wild-type. Outer Left Sequence: cgccgtggttaacctcttta. Outer Right Sequence: ttatcggacaataggcggac. Inner Left Sequence: ctgttgactcccaacaccct. Inner Right Sequence: ttgcaaaagaaattttcgcc. Inner Primer PCR Length: 2357. Estimated Deletion Size: about 850 bp. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/ Reference: Miranda-Vizuete A, et al. FEBS Lett. 2006 Jan 23;580(2):484-90.
VZ119 C. elegans vzEx32. Show Description
vzEx32 [trx-3p::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. GFP expression in intestine. Reference: Jiménez-Hidalgo M, et al. Free Radic Biol Med. (2014) 68:205-219.
VZ12 C. elegans trxr-2(tm2047) III. Show Description
Superficially wild-type. tm2047 removes bases -128 to +380 relative to the start of the trxr-2 coding sequence (removing part of the proximal promoter). Reference: Cacho-Valdez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.
VZ13 C. elegans trx-2(tm2720) V. Show Description
Superficially wild-type. Reference: Cacho-Valdez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.
VZ132 C. elegans vzEx36. Show Description
vzEx36 [trx-3p::trx-3::GFP + rol-6(su1006)]. Pick Rollers to maintain. trx-3 translational GFP fusion. GFP expression in intestine. Reference: Jiménez-Hidalgo M, et al. Free Radic Biol Med. (2014) 68:205-219.
VZ14 C. elegans trxr-2(tm2047) III; trxr-1(sv47) IV. Show Description
sv47 deletion removes bases 721-2383 of the trxr-1 genomic sequence (as measured from the start of the trxr-1 coding sequence). tm2047 removes bases -128 to +380 relative to the start of the trxr-2 coding sequence (removing part of the proximal promoter). tm2047 outcrossed 6x. sv47 outcrossed 10x. Reference: Cacho-Valadez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.
VZ149 C. elegans vzEx41. Show Description
vzEx41 [dnj-27p(2kb)::dnj-27::dnj-27 3'UTR + unc-122p::GFP]. Superficially wild-type. Pick GFP+ to maintain. Reference: Muñoz-Lobato F, et al. Antioxid Redox Signal. 2014 Jan 10; 20(2): 217-235.
VZ15 C. elegans trxr-2(ok2267) III. Show Description
Superficially wild-type. ok2267 removes bases +114 to 1751 relative to the start of the trxr-2 coding sequence. Reference: Cacho-Valdez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.
VZ17 C. elegans trxr-2(tm2047) III; trx-2(tm2720) V. Show Description
Superficially wild-type. Reference: Cacho-Valdez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.
VZ184 C. elegans vzEx60. Show Description
vzEx60 [dnj-27p(2kb)::dnj-27::YFP::KDEL]. Superficially wild-type. Pick YFP+ to maintain. Fluorescence should be easily detected under a dissection scope if present, but array has low transmission rate. Reference: Muñoz-Lobato F, et al. Antioxid Redox Signal. 2014 Jan 10; 20(2): 217-235.
VZ189 C. elegans vzEx65. Show Description
vzEx65 [dnj-27p(2kb)::GFP]. Superficially wild-type. Pick GFP+ to maintain. Reference: Reference: Muñoz-Lobato F, et al. Antioxid Redox Signal. 2014 Jan 10; 20(2): 217-235.
VZ21 C. elegans trxr-2(ok2267) III; trxr-1(sv47) IV. Show Description
sv47 deletion removes bases 721-2383 of the trxr-1 genomic sequence (as measured from the start of the trxr-1 coding sequence). ok2267 removes bases +114 to 1751 relative to the start of the trxr-2 coding sequence. ok2267 outcrossed 6x. sv47 outcrossed 10x. Reference: Cacho-Valadez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.
VZ22 C. elegans trxr-2(ok2267) III; trx-2(tm2720) V. Show Description
Superficially wild-type. ok2267 removes bases +114 to 1751 relative to the start of the trxr-2 coding sequence. Reference: Cacho-Valdez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.
VZ262 C. elegans trx-3(tm2820) IV; vzEx96. Show Description
vzEx96 [trx-3p::trx-3::trx-3 3'utr + unc-122p::GFP]. Pick GFP+ to maintain. GFP expression in coelomocytes. Reference: Jiménez-Hidalgo M, et al. Free Radic Biol Med. (2014) 68:205-219.
VZ42 C. elegans vzEx1. Show Description
vzEx1 [trxr-2p::trxr-2::GFP + rol-6(su1006)]. Rollers. Pick rollers to maintain. Reference: Cacho-Valdez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.
VZ454 C. elegans gsr-1(tm3574)/qC1 dpy-19(e1259) glp-1(q339) nIs281 III. Show Description
nIs281 [myo-2::RFP] integrated near qC1. Recombination between nIs281 and qC1 has been reported. Fails to complemement all markers on qC1. Heterozygotes are WT and segregate WT, Dpy Sterile, and tm3574 homozygotes. gsr-1(tm3574) is embryonic lethal. gsr-1(m+,z-) animals are viable and reach adulthood with no visible phenotype and lay eggs that invariably arrest at the pregastrula stage; they are slightly short-lived, have increased mitochondrial fragmentation, decreased mitochondrial DNA content and have induced mitochondrial UPR measured by hsp-6::GFP levels. gsr-1(m-,z-) have aberrant perinuclear distribution of interphasic chromatin. NOTE: The RFP-labeled balancer is reportedly not entirely stable in this strain and will occasionally segregate recombinants of two types: sterile RFP+ animals (most likely homozygous qC1 [nIs281] worms that are able to grow to adulthood but do not develop germline), and non-RFP animals that lay viable progeny. Maintain by picking fertile RFP+ animals and confirming that non-RFP progeny lay 100% arrested embryos. Reference: Mora-Lorca JA, et al. Free Radic Biol Med. 2016 Jul;96:446-61.