Search Strains

pxIs10 [pha-4::GFP::CAAX + rol-6(su1006)]. Roller line that has GFP localized to the plasma membrane of the pharynx, gut and rectal cells in embryos and the somatic gonad during L2-L3 larval stage and beyond. Reference: Portereiko MF & Mango SE. Dev Biol. 2001 May 15;233(2):482-94.

Heterozygotes are WT and segregate WT, Dpy(ts) Steriles and dead embryos/larvae.

Stress sensitive (UV light and heat). Slightly short-lived. Morphology is normal.

Class I supersized lipid droplet mutant. Peroxisomal import defective. Homozygous viable. TGT-->TAT mutation, 5' flanking sequence acatttattctgttggacgt, 3' flanking sequence tattcaggagcacgcagtag .

WT.

Strain throws WT and Uncs. Maintain by picking WT.

WT strain.

WT strain.

WT strain.

WT strain.

DpyUnc.

Strain throws WT and Uncs. Maintain by picking WT.

Strain throws WT and Uncs.

Bli. Unc.

WT strain.

WT strain.

WT strain. Occassionally Uncs appear.

Dpy. Throws males.

Strain throws WT and Uncs. Maintain by picking WT.

Strain throws WT and Uncs. Maintain by picking WT.

Strain throws WT and Uncs. Maintain by picking WT.

FREE DUPLICATION. Strain throws WT and Uncs. Maintain by picking WT.

Hets are WT and segregate WT, Unc-4 and paralysed DpyUnc (mnC1). Maintain by picking WT.

Defective in FITC dye filling.

Animals are DpyUncVul. Can mate at low frequency. N2 males X SP1377 fail to give male progeny. Weak unc-7 allele when not in lin-2 background.

Hets are WT and segregate WT, dead eggs, paralyzed DpyUnc and males. Maintain by picking WT.

Dye-filling mutant.

Dye-filling mutant.

Dye-filling mutant.

Dye-filling mutant.

Maintain strain by picking WT hermaphrodites. Segregates WT, dead eggs, paralysed DpyUnc and males.

Hets are WT and segregate WT, paralysed DpyUnc, L1 Lethal Unc-4s and males. Maintain by picking WT.

Hets are WT and segregate WT, dead eggs, paralysed DpyUnc and males. Maintain by picking WT.

Dye-filling defective. Reference: Starich TA, et al. 1995 Genetics 193:171-88

DpyUnc.

Hets are WT and segregate WT, paralysed DpyUnc, Sterile Unc-4, and males. Maintain by picking WT.

Heterozygotes are WT and segregate WT, dead eggs and UncVul.

Temperature sensitive mec-8 allele.

Temperature sensitive mec-8 allele, mechanosensory abnormal at 25 C. Reference: Spike CA, et al. Mol Cell Biol. 2001 Aug;21(15):4985-95.

Hets are WT and segregate WT, Sterile Unc-4, and paralysed DpyUnc. Maintain by picking WT.

Dye-filling mutant.

Unc strain. Throws males (ts).

Animals with the duplication are WT. Animals which have lost the duplications are DpyUncNcl. Maintain by picking WT. Males containing mnDp84 are not fertile.