| RG3396 |
C. elegans |
Y67A6A.1(ve896[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 583 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTATTAAAATACAATACTAAAAGATTCCT ; Right flanking sequence: CTTTTATGCTACGAACGCAGTGAAAAACTC. Y67A6A.1 sgRNA A: GTCGAGAAACTGAAGCAAAA; Y67A6A.1 sgRNA B: CTCTGCTCGAGTCACAACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3397 |
C. elegans |
F59B2.14(ve897[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1106 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTAAAATGTCCTTAATCATGAAACTTCTT ; Right flanking sequence: GATTCATCATATGTAGCGCAAAGCCATTCA. F59B2.14 sgRNA A: ACTTTCGTCGGTTCTCTGCT; F59B2.14 sgRNA B: AACTACAAGTGGCGAAAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3398 |
C. elegans |
C45B11.6(ve898[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1273 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCCGATTTTCCACCACTTGAAATTGATCCT ; Right flanking sequence: ATTGGAAGATAGATATTTGAATTTGACAAG. C45B11.6 sgRNA A: TCAAGCTTCCAATAGTCATC; C45B11.6 sgRNA B: ATATCTTTCGAGCATCTCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3399 |
C. elegans |
Y34D9A.7(ve899[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 6469 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAGTAAAAAAATGTCTGAAGATGGAGAAAT ; Right flanking sequence: ATTCATCGGCACCCCGATCTTCTCCCGCCG. Y34D9A.7 sgRNA A: ATCACTTTCACCCAATTCGG; Y34D9A.7 sgRNA B: TCCGAAATTGATTCTCCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3400 |
C. elegans |
+/mT1 [umnIs52] II; rps-13(ve900[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous larval arrest. Deletion of 776 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 ve900 homozygotes (larval arrest), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TCCAGGTTGGTGGAAGCTGACGCTTGGTCT; Right flanking sequence: ACCCATGGTTGATGCGGATTACCTGAAAGA. rps-13_C16A3.11 sgRNA A: TGTAGTATCTAGCCAAACGG; rps-13_C16A3.11 sgRNA B: CGCATGCACAATCCAGGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3401 |
C. elegans |
rps-10(ve901[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 [umnIs58] I; +/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Egl, Emb. Deletion of 479 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 Egl adults that have no viable eggs or hatch a few sickly progeny (ve901 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: CATTTATTGTGGTGGTGGGGCTCCACGGCC; Right flanking sequence: AGGTACTCATAGATGAGCTTGGTGTGGCTT. rps-10 sgRNA A: GAATCCGGCTCTGTAGACTG; rps-10 sgRNA B: CAGTCACTCCCTCGTTGAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3402 |
C. elegans |
ZK993.5(ve902[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 3478 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAGTGATAACGGGTGTGTTGCAATACCA ; Right flanking sequence: TATTTTAATCAGTTATGATAACTTTATGAT. ZK993.5 sgRNA A: CCAAGTAAGAATTATAGTGG; ZK993.5 sgRNA B: TATTAGCATATCCAACAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3403 |
C. elegans |
ZK1240.9(ve903[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1214 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttgttgttcaatttatcgcgtgtgtggcaa ; Right flanking sequence: CGCAGGCATTGGCCAAGTTGAAAACTATCG. ZK1240.9 sgRNA A: atttccaaccttgccgaact; ZK1240.9 sgRNA B: ACGGCTTTATGAAGAAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3404 |
C. elegans |
pho-6(ve904[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1584 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAGCATAAAGCAATGCAGAAAGTGTTCCA ; Right flanking sequence: GCTTGCATTATTATTAAATTCGCAGTTGAA. pho-6 sgRNA A: AATCTTCAATTCCAGCACGA; pho-6 sgRNA B: AATTTGGAGACACGGAGACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3405 |
C. elegans |
F56A6.5(ve905[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1286 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCACAAGCACATTTAATTTTTCAAACCCCC ; Right flanking sequence: GCATTCAGTAACCTTCATCGCAAAAATAGT. F56A6.5 sgRNA A: GATTTCTTCATGACTCCTGA; F56A6.5 sgRNA B: AGTATATGCTATGATGAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3406 |
C. elegans |
tbx-32(ve906[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1714 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTGAAAAAGGAAAGAGGGGTGTGGTCAAT ; Right flanking sequence: GGATGACAACGCTATCTTTGAGCATTTTTT. tbx-32 sgRNA A: ATGGAGCATTATCAAGAAGG; tbx-32 sgRNA B: TCCACGTTTTCTTCAAGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3407 |
C. elegans |
slc-17.5(ve907[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1674 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTCCCCATTCTTCAGCAGTTCCAACAGTC ; Right flanking sequence: GATAGTGATAATCCGATGTGAGCTGTCATT. slc-17.5 sgRNA A: TTGTAATATGAGATCATGAG; slc-17.5 sgRNA B: ATGTATGTGCAACTCAACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3408 |
C. elegans |
+/nT1 [umnIs49] IV; C37C3.18(ve908[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 801 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ arrested larvae (ve908 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GGAGATCCAGTTGTGCATGTTCTTGTGCCC; Right flanking sequence: TATTTATCATTTGTAAGTACTAACAAGAGA. C37C3.18 sgRNA #1: AAATGGGCGCGAGTTTGTGT; C37C3.18 sgRNA #2: TCACGAGTCCGGTTGATATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3409 |
C. elegans |
tsp-20(ve909[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTTGGGGCTATCACTCAAAGCACAGCCCT ; Right flanking sequence: AGGTATGAAATGAACAATTGACATTTTGAA. tsp-20 sgRNA A: CAAGAGTACACATCAACGGA; tsp-20 sgRNA B: AAACTATACTTACCACAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3410 |
C. elegans |
phf-34(ve910[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 2012 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTAACTATGAGAAATTATACTAAAATACAG ; Right flanking sequence: ATAGCAATCGAAATCACTATAAACTATTTA. phf-34 sgRNA A: ACAAACGTAGAGTGTAACGA; phf-34 sgRNA B: CGATTTTACACAGTTCGAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3412 |
C. elegans |
B0393.6(ve912[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1655 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATTGGGAGTAATATGAAGAGTTCTGGAAG ; Right flanking sequence: CGGAAAAGTTGCGGAGCGAGCATCATATTC. B0393.6 sgRNA A: GTAAAATGAGGTCAAAATGA; B0393.6 sgRNA B: GGCACGGCCTGACAATATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3413 |
C. elegans |
ZC190.4(ve913[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence:AAAAAGTTGCGACTCCATAAATATGCTCCT ; Right flanking sequence:TTTCAATTTACAAAAATAGGTTAGCCATGT. ZC190.4 sgRNA #1:TATGTCATGTCTTGGAAGAG ZC190.4 sgRNA #2:GATGGGGTTATTACACAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3414 |
C. elegans |
pipp-4P(ve914[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/sC1(s2023) [dpy-1(s2170) umnIs41] III. Show Description
umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous ste. Deletion of 7788 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate2 (ve914 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: AAACCCCCTAAAATCTTCAAATTTTTCTGT; Right flanking sequence: TCAGGGTATATGCAAAAGATTCGAGCTCTC. Y71H2AM.2-sgRNA A: AGGAATGGACGTACCACCAG; Y71H2AM.2-sgRNA B: AAATTAGCGGGAAATTTGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3415 |
C. elegans |
taf-8(ve915[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mIn1 [dpy-10(e128) umnIs43] II. Show Description
umnIs43 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 1934 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve915 homozygotes), and Dpy non-GFP mKate2+ (mIn1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: GAATGCTTCCTCAACACAATACATTTATTA ; Right flanking sequence: ACGACTACGGCAATTATGAGGATGAAGAGA. taf-8 sgRNA A: GGAGACCGACTATTGCAGGA; taf-8 sgRNA B: TGTCGCGTATCGGAGGGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3416 |
C. elegans |
prx-2(ve916[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Maintain by picking wild-type GFP+ mKate2+. ve916 homozygotes are thin, slow-growing, lay small, slow-growing broods. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 thin slow growing hermaphrodites that can be maintained as a homozygous slow growing population (ve916 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Deletion of 1288 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCTTCCCAATAATACACTACACTGTACCCT; Right flanking sequence: TGGTCATTCTACAATAACTGAAAGCATTTT. prx-2 sgRNA A: AGGAATAGTGATAGTGGGGG; prx-2 sgRNA B: CTCTATTTCCTTCGATCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3417 |
C. elegans |
Y38C1AA.19(ve917[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1665 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTCCTAAGTTATTTTCTTATCGGACTCCT ; Right flanking sequence: tttcggctgttttccggctggcagcgAGTT. Y38C1AA.19 sgRNA A: CATTTTATTGACGACTGATA; Y38C1AA.19 sgRNA B: aactatacgttgtcggctgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3418 |
C. elegans |
hpo-39(ve918[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 712 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tttctgttataagcgtcagctctcaactct ; Right flanking sequence: AAAGCGAAGAAATCCGTCTTCACCATAGGC. hpo-39 sgRNA A: ctcaggatagataacatcgt; hpo-39 sgRNA B: CCGGGAGATAAGGACCAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3419 |
C. elegans |
T27F6.6(ve919[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 3262 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAGAAAGTCGACATGGAGCCGGTTTTCCG ; Right flanking sequence: CGGAAGGCTTTGAAGGCCGCAAAACAGGCG. T27F6.6 sgRNA A: ACGCGGCGAATGATTCCCGG; T27F6.6 sgRNA B: TTATTGGCTTAACGTTGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3420 |
C. elegans |
Y48G1C.6(ve920[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1281 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATCAGAATCTGATTCGTGGCCGTTTTCCT ; Right flanking sequence: TGGAGACAGCAAATTGGCACACACGCAGAG. Y48G1C.6 sgRNA A: CCGCCAGAACTTTAGGAACT; Y48G1C.6 sgRNA B: GAACGAAGGGGCAAGACTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3421 |
C. elegans |
F44E5.4 & F44E5.5(ve921[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 4584 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence:AATTAATCAACTTCCTCAACAGTAGGTCCT ; Right flanking sequence:AATGTTGTTCTAATAAATTTACAAAAATCT. sgRNA: AATCCTAACAATTATCCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3423 |
C. elegans |
F25B4.7(ve923[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1194 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGTTCACCAGGGCTCCATGGAAAAATGCCT ; Right flanking sequence: CATCTCTCGTTTTTATATAATTTTCACTAC. F25B4.7 sgRNA A: TTACACGAAGGAAGGACCCA; F25B4.7 sgRNA B: TCGGTGTACACAGCAGTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3425 |
C. elegans |
T23B12.5(ve925[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1235 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTCCCGTTTTGTTGGCAAATGAGTATCCG ; Right flanking sequence: TGTAGGCATTCAAAACAAGTATCGATAGAA. T23B12.5 sgRNA #1: TGTTTTCCAATCCTTCTCAT; T23B12.5 sgRNA #2: TATCGCTTTGAAGCTTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3426 |
C. elegans |
gsto-1(ve926[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1355 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGACTGGTTTTAATATCAAAGGCCCAAATC ; Right flanking sequence: AGGTTCCGCATCTCCTTTTCGAATTGCTTT. gsto-1 sgRNA A: ATAATTCAATTCCTGGTGCG; gsto-1 sgRNA B: AAAGATCCCTTTGATAGCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3427 |
C. elegans |
alkb-7(ve927[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1410 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCTAGGCATCAGAAGATCCATAATCAGTT ; Right flanking sequence: AAATTATGAAATTTTATCAAATGTTGCAGA. alkb-7 sgRNA A: CATCCTTCTGATCCTTGTGC; alkb-7 sgRNA B: GGAACTGTGGCCGAAGGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3428 |
C. elegans |
cal-1(ve928[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1987 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTACGAACTCTTCGTAATCAATTTCCCC ; Right flanking sequence: CGGTTTGCTTACCATATCTCTGGCGAGTCG. cal-1 sgRNA A: AAGTTGATGTGGATGGAGAC; cal-1 sgRNA B: TTCATGCTCCATGTTAGTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3430 |
C. elegans |
R02F2.1(ve930[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 4303 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCATCTTCTACTGTCATTTCCAAATTCCCA ; Right flanking sequence: CTCTCATACTAATACAAATTCTATATATAT. R02F2.1 sgRNA A: CTCGTCTTCGTTCTGTAACA; R02F2.1 sgRNA B: AGATGGTGTGTGGGGGAATG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3431 |
C. elegans |
agt-1(ve931[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 840 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTGAAAATCTGAGTTCAGCGCCTTCTGCCT ; Right flanking sequence: CGGATGATCATTTCTACTTTAATAAAATTG. agt-1 sgRNA A: GAAGAAGCGTCGCCTATTGC; agt-1 sgRNA B: CGACTTCATAGACGCACTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3432 |
C. elegans |
alh-9(ve932[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1769 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tcagttttcgtcgtcataaacaatctgccc ; Right flanking sequence: TGGAGGTCGCGAATCAGGATCCGACTCCTG. alh-9 sgRNA A: gtatgggcggagcgagacac; alh-9 sgRNA B: GGCGGAGAAAAGGAGACCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3433 |
C. elegans |
gst-22(ve933[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1174 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCATCATTATTTTTTCTTTCACaaaaaaa ; Right flanking sequence: TTTGTAAGAGGGCATATTTTATTTGTGAAG. gst-22 sgRNA A: aCAATTCACACAAGCGTCAC; gst-22 sgRNA B: CTGACTTACTTTGATGCTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3434 |
C. elegans |
gsto-2(ve934[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1049 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAGTGCAATTTGTCATCATGTAGGCTTCCG ; Right flanking sequence: TGGATTGTAAATATCTTCTCTTCGTTACAA. gsto-2 sgRNA A: GGGAAGGAAGTAAACACAGG; gsto-2 sgRNA B: GGAGCACCAAACTTTGACTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3435 |
C. elegans |
W01A11.1(ve935[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2962 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCCCGTTGCAATCGGGGTTCTCGCCGCCG ; Right flanking sequence: AGGTCTCCCGTCATTCCTATAACATCACCC. W01A11.1 sgRNA A: CGGCAACAAATTCCATACGG; W01A11.1 sgRNA B: CTATGACCGTACACCAATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3436 |
C. elegans |
srp-7(ve936[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCCGAATCTCTCGCATTTTCTCCACTTTC ; Right flanking sequence: TTTTCAAGCAGATCATCCTTTCCTCTTTAT. srp-7 sgRNA A: CATTGCCTTAGCTCTATCTC; srp-7 sgRNA B: ACGATTGGCTTTATAGCTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3437 |
C. elegans |
gln-5(ve937[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1358 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GCCAATTGAAAGCTAAAAATTCAGAAAGAT ; Right flanking sequence: TTGACCGAGAGGAAGACGAGTTTCGTAGTT. gln-5 sgRNA A: CATGCGTTAGTTTATTCGGG; gln-5 sgRNA B: GCCACCATCGATCATTTCAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3438 |
C. elegans |
let-767(ve938[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Larval lethal. Deletion of 1104 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) early larval lethal (ve938 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: ATCCATGAGCTCGAGTTGAAGTTGATGCGT; Right flanking sequence: TGGAATTTACAGAATTTCAATGGAAATAAC. let-767 sgRNA A: GATGTATCCGGTGGTGTCTG; let-767nsgRNA B: CACTGGCAAGCCATGTTACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3439 |
C. elegans |
deb-1(ve939[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Maintain by picking wild-type GFP+ mKate2+. Deletion of 7456 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead embryos (ve939 homozygotes; embryonic lethal), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Left flanking Sequence: CCATCAGAATGGCCATTCTCTTCGCAGCCG; Right flanking sequence: ttgtaagatttgtacagatttttcgagctt. deb-1 sgRNA A: ACAGGAGAACGATATTGTGG; deb-1 sgRNA B: accatccataagtctcaagg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3440 |
C. elegans |
rnp-7(ve940[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Maintain by picking GFP+ Rollers (GFP expression in both pharynx and distal tip cells). Heterozygotes are Rol GFP+ (GFP expression in both pharynx and distal tip cells), and segregate Rol GFP+ (GFP expression in both pharynx and distal tip cells), non-Rol GFP+ (GFP only in pharynx) ve940 homozygotes (Unc, arrest as larvae with a curled tail). qC1[qIs26] is homozygous lethal (unknown stage). Deletion of 1847 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGCTTCGATATCCACCACCGGATCCTCCA; Right flanking sequence: TGGAAGATATTGCACTGGTGGTCGTGCTTC. rnp-7 sgRNA A: GGAAGCCGATACAGTACAGG; rnp-7 sgRNA B: ACTAGTAGGTCCTGGCATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3441 |
C. elegans |
arx-6(ve941[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)] III. Sterile. Deletion of 651 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) grotty adults with vulval blip (ve941 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: GCGTCACACGCTCCAGGCAGCTCTCTGTCT; Right flanking sequence: GAATTTTTGAAGCGTTTCAATTAAttttct. arx-6 sgRNA A: TGAGCAATTCAGTTCGCAGG; arx-6 sgRNA B: TTCAGCAGAAACACGGGCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3442 |
C. elegans |
col-58(ve942[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 643 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acattacaccgtaattacactttatcacct ; Right flanking sequence: AGGTGATGACATATCAGTGCTTCGTCACGA. col-58 sgRNA A: aaaggaaggatgggttggtg; col-58 sgRNA B: GGAGTTCCGGGATCATCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3443 |
C. elegans |
avr-14(ve943[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Prone to rupture at vulva, can be maintained as a homozygous population. Deletion of 5798 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAGGTAATCGTTTAACACTACGATATGCT ; Right flanking sequence: agggctttttcttttttctctctttatcct. avr-14 sgRNA A: GATAAATCTAATCGAAGTGG; avr-14 sgRNA B: aagggacaggggacgaaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3444 |
C. elegans |
lonp-2(ve944[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 5206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTACTGCCAGGCGCAAGCCTTAAAATACCT ; Right flanking sequence: TGGGCCATCTGCTGGAACAGGATTAGCGTG. lonp-2 sgRNA A: CACTTTAATTTCGACCTGAT; lonp-2 sgRNA B: TCTTTATTCACCGCACCTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3445 |
C. elegans |
T02C1.2(ve945[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1978 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAACTCTTTTGCTTACCAGAGTATTTTAT ; Right flanking sequence: TGGTAAAAAAACCATGAATTTATAATTTCC. T02C1.2 sgRNA A: TCATATTTTCCAATTCCAGG; T02C1.2 sgRNA B: GTTCCGTATTCGGTGTCTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3446 |
C. elegans |
Y49E10.27(ve946[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCAGTTCTGAGGGGTTTTTTCAATATCCG ; Right flanking sequence: aggcacagatttctcaattgatttcgcatg. Y49E10.27 sgRNA A: CATAAATGAACGAACACCGC; Y49E10.27 sgRNA B: ctacaaaaaatgcggagacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3447 |
C. elegans |
+/mT1 [umnIs52] II; mdh-2(ve947[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 1490 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae, (ve947 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: tctgttcatcatgtttcacgtggatgagag; Right flanking sequence: CGGCAACTCCTGGAGTATTGACGACGTCGT. mdh-2 sgRNA A: ggaagagacacagacagcgc; mdh-2 sgRNA B: ATCAATGTGCGAAAGATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3448 |
C. elegans |
otub-1(ve948[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 972 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTTTTCTTCTCTAAAAATTAAACATTTT ; Right flanking sequence: GATGTGCTCTCTCTTTCTCATCACCACTCC. otub-1 sgRNA A: CTTACAGGTAACAGGAACTA; otub-1 sgRNA B: GGGAGAGAAGACAAGAGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| RG3449 |
C. elegans |
K03B8.6(ve949[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1958 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATGTGTGTTGGCCGTGTGTATGAAAGAGG ; Right flanking sequence: AAAAACgttttacgtgtatttttgttttat. K03B8.6 sgRNA A: CGTGGTTTGAGTCTGTCTGG; K03B8.6 sgRNA B: AAGAAAAGGCGGTGAAGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|