Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
RB1111 C. elegans srp-7(ok1090) V. Show Description
F20D6.4 Homozygous. Outer Left Sequence: ATTCGTTCTTTTGACACCGC. Outer Right Sequence: TTTCATCTTTTTCCGGCATC. Inner Left Sequence: CAACATAACCTTTCGTCGCA. Inner Right Sequence: CCGCAACAGCTACAGTACCA. Inner Primer PCR Length: 2226. Estimated Deletion Size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3436 C. elegans srp-7(ve936[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1601 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCCGAATCTCTCGCATTTTCTCCACTTTC ; Right flanking sequence: TTTTCAAGCAGATCATCCTTTCCTCTTTAT. srp-7 sgRNA A: CATTGCCTTAGCTCTATCTC; srp-7 sgRNA B: ACGATTGGCTTTATAGCTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.