Homozygous viable. Prone to rupture at vulva, can be maintained as a homozygous population. Deletion of 5798 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATAGGTAATCGTTTAACACTACGATATGCT ; Right flanking sequence: agggctttttcttttttctctctttatcct. avr-14 sgRNA A: GATAAATCTAATCGAAGTGG; avr-14 sgRNA B: aagggacaggggacgaaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.