| SSR1578 |
C. elegans |
ssrIs1248. Show Description
ssrIs1248 [ges-1p(deltaB)::rpl-22::3xHA + ges-1p(deltaB)::GFP + pSM(empty vector)]. ges-1p(deltaB) is an INT1-specific promoter. Strain can be used for INT1-specific RiboTRAP experiments. Generated in N2 background. Reference: Liu C, et al. bioRxiv 2025.10.03.680215; doi: https://doi.org/10.1101/2025.10.03.680215
|
|
| SSR1605 |
C. elegans |
ssrIs1251. Show Description
ssrIs1251 [pho-1p::rpl-22::3xHA + pho-1p::mCherry + pSM(empty vector)]. pho-1p is an INT2-9-specific promoter. Strain can be used for INT2-9-specific RiboTRAP experiments. Generated in N2 background. Reference: Liu C, et al. bioRxiv 2025.10.03.680215; doi: https://doi.org/10.1101/2025.10.03.680215
|
|
| ST25 |
C. elegans |
ven-1(nc25) V. Show Description
Ventral cord displacement and detachment. Muscle attachment defects. Some larval lethality.
|
|
| ST26 |
C. elegans |
ven-1(nc26) V. Show Description
Ventral cord displacement and detachment. Muscle attachment defects. Some larval lethality.
|
|
| ST28 |
C. elegans |
ven-1(nc28) V. Show Description
Ventral cord displacement and detachment. Muscle attachment defects. Some larval lethality.
|
|
| SU180 |
C. elegans |
itr-1(jc5) jcIs1 IV. Show Description
jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. itr-1(jc5) is cold sensitive. Progeny of homozygotes reared at 15C exhibit 95% maternal effect lethality, while progeny of homozygotes reared at 20C exhibit 15.2% lethality. Arrested embryos are defective in epithelial morphogenesis. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4.
|
|
| SV1450 |
C. elegans |
unc-119(ed3) III; heIs145 IV Show Description
heIs145 [rps-27::loxP::NLS::mCherry::let858 UTR::eft-3::tagBFP::tbb-2 UTR::loxP::NLS::GFP::let-858 UTR + unc-119(+)] IV. Maintain at 15-25C. heIs145 expresses a read-out construct used to visualize CRE activity and specificity, and to test whether CRE expression is likely to induce loss of a gene of interest (tagBFP in this case) in a given tissue. Expression of CRE will result in a change from mCherry to GFP and loss of tagBFP expression in those cells where CRE is active. Reference: Ruijtenberg S & van den Heuvel S. Cell. 2015 Jul 16;162(2):300-13.
|
|
| SV2071 |
C. elegans |
he317[eft-3p::Lox2272::egl-13-NLS::tagBFP2::let-858 3'UTR::Lox2272::egl-13-NLS::mCherry::let-858 3'UTR] IV; heSi220 X. Show Description
heSi220 [lin-31p::Cre] X. Vulval lineage is marked through activity of a Cre-dependent reporter (blue-to-red switch). All cells in the animal are expressing BFP, except for vulval cells which are expressing mCherry. he317 was inserted into the cxTi10816 site using CRISPR/Cas9. Reference: van der Vaart A, et al. Sci. Adv. 2020 May; 6(21): eaay3823. PMID: 32494730.
|
|
| SV411 |
C. elegans |
heDf1 maIs103/lon-2(e678) unc-9(e101) X. Show Description
maIs103[rnr::GFP unc-36(+)] X. The heDf1 deletion includes cdk-4. Heterozygotes produce 1/4 thin, sterile, uncoordinated animals that fail to undergo postembryonic somatic cell divisions. heDf1 mutants are of L1 size, smaller than cdk-4 mutants. lon-2 and unc-9 do not exactly balance heDf1, but unc-9 is pretty close. It should also be possible to follow the heterozygotes by looking at the GFP. Despite trying, unable to separate the maIs integration from heDf1 or the other cdk-4 alleles. By maintaining animals with GFP (visible especially in early animals and in eggs) you should be able to maintain heDf1. rnr::GFP is expressed during S-phase in heterozygous animals. rnr::GFP expression is not detected in heDf1 animals. maIs103 is tightly linked to heDf1. Maintain by picking several single animals and scoring for 1/4 mutant progeny.
|
|
| SX1359 |
C. elegans |
pash-1(mj100) I; mjEx331. Show Description
mjEx331 [eft-3p::pash-1::GFP::unc-54 3'UTR + myo-2p::mCherry::unc-54 3'UTR]. Maintain at 25C. Array rescues pash-1 lethality and should be self-selecting at 25C. Pick mCherry(+) animals to confirm presence of array. SX1359 was derived from SX1137 pash-1(mj100). mj100 homozygotes can be re-isolated by raising SX1359 at permissive temperature (15C) and picking animals that have lost the array. Reference: Lehrbach NJ, et al. RNA. 2012 Dec;18(12):2220-35.
|
|
| SX523 |
C. elegans |
prg-1(n4357) I; prg-2(n4358) IV. Show Description
21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Sterile at 25.5C; maintain at 20C or below.
|
|
| SX922 |
C. elegans |
prg-1(n4357) I. Show Description
21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Superficially WT. Deletion breakpoints: GTTTTCTTTCCTTGGAGAGGT//GATGCTCATATTGTAATCT.
|
|
| TBD307 |
C.elegans |
dhc-1(he255[epdz::mCherry::dhc-1]) I; utdSi51 II. Show Description
utdSi51[mex-5p::tomm-20(aa 1-55)::halotag::lov::tbb-2 3Â’UTR] II. Maintain at 23C and protect from light. Strain is sickly, seems to grow best and lay more eggs at 23C. Upon stimulation with 488nm light, the LOV-ePDZ optogenetic system will recruit mitochondria to the dynein heavy chain in the worm embryo. Embryonic cell divisions can be stopped by if mitochondrial recruitment is stimulated in early development. Room light can also induce mitochondria re-localization and cause infertility; store this strain in the dark. Reference: Fan X, et al. G3 (accepted).
|
|
| TG4298 |
C. elegans |
lem-3(gt3310[eGFP::STag::lem-3[S192A S194A]]) I. Show Description
Endogenous lem-3 locus carries GFP tag and two misense mutations in putative phosphorylation sites [S192 S194]. Homozygous viable, though [S192A S194A] mutants exhibit increased embryonic lethality after irradiation. Reference: Hong Y, et al. Nat Commun. 2018 Feb 20;9(1):728.
|
|
| TG4300 |
C. elegans |
lem-3(gt3311[eGFP::Stag::lem-3[Y556A G558A]]) I. Show Description
Endogenous lem-3 locus carries GFP tag and two misense mutations in conserved residues [Y556A G558A] of GIY-YIG nuclease domain. Homozygous viable, though [Y556A G558A] mutants exhibit increased embryonic lethality after irradiation and abolished localization of GFP::LEM-3 at the midbodies. Reference: Hong Y, et al. Nat Commun. 2018 Feb 20;9(1):728.
|
|
| TG4319 |
C. elegans |
lem-3(tm3468) I. Show Description
Homozygous viable. Increased embryonic lethality after irradiation.
|
|
| TJ101 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ103 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ104 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ105 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ1052 |
C. elegans |
age-1(hx546) II. Show Description
Long life. Normal fertility. Not Temperature sensitive. Stress tolerant.
|
|
| TJ106 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ107 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ108 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ112 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ119 |
C. elegans |
Show Description
Mean lifespan 12.3 days. Carries Ts of BergBO. Carries Daf+ of N2. Males fertile. One of the shortest lived strains. No fertility at 25C.
|
|
| TJ121 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ123 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ127 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ131 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ146 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ202 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ207 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ215 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ225 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ236 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ239 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ242 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ246 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ251 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ257 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ264 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ265 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ273 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ274 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ277 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ282 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ286 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ290 |
C. elegans |
Show Description
No fertility at 25C.
|
|
| TJ292 |
C. elegans |
Show Description
No fertility at 25C.
|
|
