Search Strains

F23H11.8. Homozygous. Outer Left Sequence: GTCGATTTCCGGTGTGTTTT. Outer Right Sequence: ACGTTGCTGAAATTTTTGGG. Inner Left Sequence: GAAACCGTGCTTTTCAAGGA. Inner Right Sequence: TTTGCCGGAAACTTCAATTC. Inner Primer PCR Length: 2991 bp. Deletion Size: 1552 bp. Deletion left flank: TGCCTACTATTAGCAATTGTGAAGAACCAA. Deletion right flank: AAAACAACGATATGCTACAAAAAATTTAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35C11.1. Homozygous. Outer Left Sequence: AGATGCCGACGTCAATTTTC. Outer Right Sequence: ACTGTTGGGCCATACTCGAC. Inner Left Sequence: AATTCGGCTCAAAAAGCTCA. Inner Right Sequence: AGGGACCGAAGAGTGGATTT. Inner Primer PCR Length: 2278 bp. Deletion Size: 1477 bp. Deletion left flank: GCGTTCCAAATTTTATATCAACGGTTGATG. Deletion right flank: AAATTAATTTACCAGTTTATTGTATTGTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04D8.1. Homozygous. Outer Left Sequence: CTGCCACGTCAAAAGAGGAT. Outer Right Sequence: AGCGTTTCCCTCAACTCTCA. Inner Left Sequence: AGGCCATGATGATCCAGAAG. Inner Right Sequence: GTTGACCAGGAAGATGGGAA. Inner Primer PCR Length: 2938 bp. Deletion Size: 1479 bp. Deletion left flank: CAGTTTGTGTAAGTGTGTATGTGGTCATTT. Deletion right flank: TATTATCCAATACTTTTTAACTACTGTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H39E23.1. Homozygous. Outer Left Sequence: ATGTCGGCGGCTGATATTAC. Outer Right Sequence: ACGGAGTCAATTTTTGACGG. Inner Left Sequence: GAGTGAACGAGAAAAAGGCG. Inner Right Sequence: CCACGTCAATCCGAGAGTTT. Inner Primer PCR Length: 2534 bp. Deletion Size: 594 bp. Deletion left flank: ACACTTTTCGCTTCGGGATCAGAGATTCCT. Deletion right flank: TCATTCGATGCTGACTGCTTGCGGGGCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02E9.1. Homozygous. Outer Left Sequence: TAAGCTCAACAGCTGCCTCA. Outer Right Sequence: CCAGATGAGACCTCTTTCCG. Inner Left Sequence: GCATCGATTTTGTTCGCTTT. Inner Right Sequence: GGTCAGTGGGATACGGATGT. Inner Primer PCR Length: 3079 bp. Deletion Size: 1209 bp. Deletion left flank: TTCTTTTGTCTTTCATTTTCCCTTCACACG. Deletion right flank: GAAATCTCCAGAAGAAAGTGACGACAAGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F28C6.6, F28C6.8. Homozygous. Outer Left Sequence: AGTGCAATTATGGGTGGAGC. Outer Right Sequence: ACGGTAGATGCAACAGGGAC. Inner Left Sequence: TCCATTCAAACCACGAGTCA. Inner Right Sequence: TTCATCATCTCCCTTTTCCG. Inner Primer PCR Length: 2510 bp. Deletion Size: 1673 bp. Deletion left flank: ACTTGTTTTATTGGACCATTTATCAATGTG. Deletion right flank: TCCACCTCGAATGCGGGAATCTCAGAACCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C33H5.14. Homozygous. Outer Left Sequence: TTTCCTAATGTCGGGGTGAG. Outer Right Sequence: CAACGGTGAGCACTTCAAGA. Inner Left Sequence: GCCGAATTTGTTGCACTGTA. Inner Right Sequence: TGGAAAGCATGATGAACCAA. Inner Primer PCR Length: 3523 bp. Deletion Size: 2298 bp. Deletion left flank: TCCTAGAGCCCATTGCATTTCTTCACCGGC. Deletion right flank: TTAGATCTTCAATGAAATTGGTCAGAAAAA. Insertion Sequence: GTGATCTTCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K11H12.1. Homozygous. Outer Left Sequence: CCATGGGACAGACTGGAACT. Outer Right Sequence: CAAACCTACGGAAAGCCAAA. Inner Left Sequence: CTCGAGGGAAGCAGTGACTC. Inner Right Sequence: AGGATCCCAAGCCAAGAACT. Inner Primer PCR Length: 2167 bp. Deletion Size: 1116 bp. Deletion left flank: TACAACTAAAATCGAGCCGCGGCGCGCCGT. Deletion right flank: GAAAAATTGGTAAAGCCTATGAAAAAGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D2013. Homozygous. Outer Left Sequence: TCTCAAAATGCCCATCCTTC. Outer Right Sequence: CGCATCATTGTTTCATCACC. Inner Left Sequence: TGGTGACACTGGATGAAGGA. Inner Right Sequence: TGTTCCCCAGAAGAATGGAG. Inner Primer PCR Length: 2586 bp. Deletion Size: 574 bp. Deletion left flank: CCGAAGAGCCGTTTTCTAAATAATATACAC. Deletion right flank: TAAGAGGCTTTGTTGTAGTAAAAATCCTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R02F2.5. Homozygous. Outer Left Sequence: GTCAACAACCGTCTCCAGGT. Outer Right Sequence: CAATGAAATCGGCGAAGAAT. Inner Left Sequence: CACCAAAATTTATCCACGGG. Inner Right Sequence: GAGGAATAGTCTGAACGCGG. Inner Primer PCR Length: 2336 bp. Deletion Size: 815 bp. Deletion left flank: CAAAATTTATCCACGGGAAGTGTCGACTGC. Deletion right flank: AAGCTGCTCCCGTGGTCTATGGATCCCAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D1053.2, D1053.1. Homozygous. Outer Left Sequence: GTCCAAAATTCCCTGACCCT. Outer Right Sequence: CAGTTCTAGTCAGCTCCCCG. Inner Left Sequence: TCTCCGACAGCATACTTCCC. Inner Right Sequence: CAGCTTCATCCCAATCCCTA. Inner Primer PCR Length: 2135 bp. Deletion Size: 1304 bp. Deletion left flank: CCAGAATGTTGCTTTAGAAGAATTTCAAGA. Deletion right flank: TCATCAGAGTCGATTGTTCCACGTCCCCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F31E8.3, F31E8.5. Homozygous. Outer Left Sequence: GCACAAGTTGTTGGGGAAGT. Outer Right Sequence: TTTTTGTCTGGGGTTGGAAG. Inner Left Sequence: TCTTTCACGGGACCTTCATC. Inner Right Sequence: ATCGGAGAACACAAGTTGCC. Inner Primer PCR Length: 2481 bp. Deletion Size: 1702 bp. Deletion left flank: TAAAATATGTAAATTTGATCATCAAAAATT. Deletion right flank: TCAATCCTCCAACGGATTCACATGTCTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T21B10.1, T21B10.2. Homozygous. Outer Left Sequence: GTCGAAGCTCAAAAGGTTGC. Outer Right Sequence: GAAAGAGTGACGAAGGTCGC. Inner Left Sequence: GTCACAAGACTCCGTGCAGA. Inner Right Sequence: CATGCCGAGAAGAAAAGAGG. Inner Primer PCR Length: 2467 bp. Deletion Size: 1161 bp. Deletion left flank: GAGAATCCACACAAGTTACTGCTTCAGCTG. Deletion right flank: TAATGGGGTCTGCCGTGCCTTTTTTCCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK512.6, ZK512.7. Homozygous. Outer Left Sequence: ACAAATGGTTGGAGAGCCAC. Outer Right Sequence: ATGCAGCTTCTCCTCCAAAA. Inner Left Sequence: AGCCCAACACAACAAAAAGG. Inner Right Sequence: GGATCTTGTTGGATCGGAGA. Inner Primer PCR Length: 3386 bp. Deletion Size: 1329 bp. Deletion left flank: TACAGCACTCTTTTTTCAGGGAGTTTGTTA. Deletion right flank: GTGCTAAAATGCCTGAATATCGTAGTAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F08F8.5. Homozygous. Outer Left Sequence: CACAAAGAGCATGCCTTGAA. Outer Right Sequence: GGTCTGAAATCTGGAGAGCG. Inner Left Sequence: GACAAAATGCGGAACGTCTT. Inner Right Sequence: GTTTGCAGATCCCAATTCGT. Inner Primer PCR Length: 2296 bp. Deletion Size: 975 bp. Deletion left flank: CGTAAATGAAAACAAATTTTGATGGAGATT. Deletion right flank: CTGAGACATTGAAATCAAATTTCCTTTGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

YY63D3A.10. Homozygous. Outer Left Sequence: AGGTGGAAGGGATGGCTATT. Outer Right Sequence: GCTTCCTTGACTCTCCGTTG. Inner Left Sequence: GAAATTTGCACTCCAGGGAA. Inner Right Sequence: TAGTCTGGAAGGAGCGCTGT. Inner Primer PCR Length: 3267 bp. NOTE: External left primer occurs twice in Y63D3A, once at coordinate 1234 and once at coordinate 3721, giving external WT products of 3493 and 1006 bp respectively. Shorter product is apparently preferred in PCR. Reactions on mutant template using ok2243_external primers thus primarily gives a product from EL(3721) and ER. Nested amplification on this product using ok2243_internal primers appears to give a product from EL(3721) (remaining primer from the external round passed to internal round by product transfer) and IR. Deletion Size: 219 bp. Deletion left flank: CCACTTCAGTCTTGATGCTGCGCTCGTGCC. Deletion right flank: TGTCACTAGCTCTATATTCAAGTCTCCTCG. Insertion Sequence: TTTTGTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C16C8.16. Homozygous. Outer Left Sequence: AAGACGACCACACTCTCGCT. Outer Right Sequence: ACACTGGGAAAAATGTTCGG. Inner Left Sequence: TGCCGATACTAAAGTTCCCG. Inner Right Sequence: GGACTACGGTAGGTGGCAGA. Inner Primer PCR Length: 3110 bp. Deletion Size: 1331 bp. Deletion left flank: ATTGTTCGAAAATTTGATGTCGGAATTGAA. Deletion right flank: GACTGTCAAAGCCGAGCTGAATGTGACGAA. Interpretation of sequence data is very speculative, and should be confirmed independently. Predominant band in PCR of mutants, about 600 bp, is probably not the full-length mutant product. Full-length mutant product is more likely a fainter band of about 1770 bp, which correlates well with deduced breakpoints and relative sizes of various bands produced by single-round amplification with external and internal primer pairs. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

okIs46 I. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

Whole-genome sequenced strain. Dpy. It has not been confirmed that this phenotype is the result of ok5083. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to ok5083, it is homozygous for 196 other mutations determined from sequence data. All mutations are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

Whole-genome sequenced strain. Dpy. The mutation responsible for this phenotype has not been identified. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). It is homozygous for 289 mutations determined from sequence data, all of which are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

Whole-genome sequenced strain. Unc. The mutation responsible for this phenotype has not been identified. This strain was isolated after EMS mutagenesis of VC2010 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). It is homozygous for 477 mutations determined from sequence data, all of which are annotated in WormBase. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200

okIs47 X. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

C18G1.4a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

okIs52 II. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

C33A11.4/tag-97. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F12F6.5. Homozygous. Outer Left Sequence: GATGTGAAGGCTGACAAGCA. Outer Right Sequence: TAACCCGTGCATTTGTTGAA. Inner Left Sequence: CTTCGAGGCCAATCATCAAT. Inner Right Sequence: GCCAAAACTATCATGGGCTG. Inner Primer PCR Length: 2904 bp. Deletion Size: 1406 bp. Deletion left flank: ttttattactttgttttatatttcaaaaac. Deletion right flank: atcaagtcgatcttcaaatcgatcaaaagc. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

okIs54 V. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

C03G6.19. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F55C7.7d. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

okIs56 II. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

M01D7.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M01D7.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

okIs57 X. Pharyngeal GFP element integrated near unc-3 Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

okIs58 III. Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

ZK1307.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

EEED8.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C54E4.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15A8.5. [NOTE (10/28/11): Possible heterozygous strain; genotype being confirmed by Moerman Lab] Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

okIs63 . Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

okIs64 . Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

okIs65 . Integrated pharyngeal GFP. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use.

K07D4.7a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F57B10.7. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Eri, reduced brood size at 20C and sterility at 25C. Slightly Him. Reference: Almeida et al, 2018. The EMBO Journal, e99325.

Eri, reduced brood size at 20C and sterility at 25C. Slightly Him. Reference: Almeida et al, 2018. The EMBO Journal, e99325.

Eri, reduced brood size at 20C and sterility at 25C. Slightly Him. Reference: Almeida et al, 2018. The EMBO Journal, e99325.

tmIs1243 [myo-2p::mCherry, X: ubc-17] X. Homozygous animals may be sensitive to starvation (grotty, low brood size). Deletion of 1634 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, wild-type GFP+ non-mCherry (ve808 homozygotes), and Lon Mec non-GFP mCherry+ (tmC30 homozygotes). Maintain by picking wild-type GFP+ mCherry+. Left flanking Sequence: TACTATATTCTGTTATTCCAAAATGCGTTT ; Right flanking sequence: ATAATGTGAACAGCACGCAAAACGGAACAA. sgRNA #1: GTTCCAGATGACAACAGACT; sgRNA #2: TGTCAAATCAGCTTTTTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous late larval lethal. Deletion of 605 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate grotty late larval to sterile (ve848 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GGAAATTATCCGTTCAACTTTGGAAAGTGA; Right flanking sequence: CCTTGCTGGTCTTAATATTAGAGTGAGTTC. trpp-6 sgRNA #1: AAAAGATCGATGTGAAGCAA; trpp-6 sgRNA #2: GCTCCGCGAAGTAAACCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 3298 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate grotty late larval to sterile (ve866 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: AAATGCTAATGTCTAAAATCCTGGTGGATA; Right flanking sequence: CGAATTGTTGAGTTTGAATTCGCCAGAATG. F46B6.6 sgRNA #1: CCAGTCGACTTCTTGAGTGA; F46B6.6 sgRNA #2: CATCTGAAGGAAAACGTGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Apparently semi-sterile. Deletion of 753 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate apparently semi-sterile adults (ve895 homozygotes) can be maintained as a homozygote with difficulty, Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GGGAGCGTTGGATCGTGAATAATATCTCCG; Right flanking sequence: TGGCTCATCTTTCTGAAAAAATATGATAAA. rpb-9 sgRNA A: AGTGAGCTCACTCAAATCGT; rpb-9 sgRNA B: CATCGTAATTATCATACCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.