Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
IMN34 C. elegans ced-4(n1162) dpy-17(e164) III; glt-3(bz34) IV; nuIs5 V. Show Description
nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. Reference: Tehrani N, et al. (2014) PLoS One 9(11):e113060.
iOP50 E. coli OP50 E. coli, rnc14::(delta)Tn10, lacz(gamma)A::T7pol camFRT Show Description
RNAi-capable OP50 strain. Tetracycline & Chloramphenicol resistant. Uracil auxotroph. E. coli B. Biosafety Level: BSL-1. Standard OP50 (CGC) was rendered RNAi competent through two modifications by phage transduction. The OP50 RNase III (rnc) allele was replaced with the deletion allele (rnc14::ΔTn10) found in HT115(DE3), and a genomically encoded IPTG-inducible T7 RNA polymerase (laczγA::T7pol camFRT) was introduced. Reference: Neve IAA, et al. G3 (Bethesda). 2019 Nov 11. pii: g3.400741.2019.
IW412 C. elegans tax-2(gk117937) I. Show Description
Maintain at 20C. Improved survival at 37C. Dauer constitutive and longer lifespan at 28C. Reference: Hwang HY, et al. Front Genet. 2020 Oct 6;11:566948. doi: 10.3389/fgene.2020.566948. PMID: 33133151
IW465 C. elegans tax-2(iw80) I. Show Description
Improvement in thermotolerance at 37C, though weaker than in null mutants. Longer lifespan than to tax-2(gk117937) null mutant. Higher frequency of dauer formation and survival at 28C than tax-2(gk117937) null mutant. Reference: Hwang HY, et al. Front Genet. 2020 Oct 6;11:566948. doi: 10.3389/fgene.2020.566948. PMID: 33133151
IZ1458 C. elegans ufIs126 V. Show Description
ufIs126 [flp-13p::acr-12::GFP + lgc-11::mCherry] V. ACR-12::GFP expression labels postsynaptic iAChRs in DD motor neurons. References: Philbrook A, et al. eLife. 2018 Jul 24;7:e35692. doi: 10.7554/eLife.35692. PMID: 30039797. Oliver D, et al. PLoS Genet. 2022 Jan 28;18(1):e1010016. doi: 10.1371/journal.pgen.1010016. PMID: 35089924. Alexander K, et al. bioRxiv 2022.10.21.512874; doi: https://doi.org/10.1101/2022.10.21.512874.
JA1334 C. elegans unc-119(e2498) III; weIs11. Show Description
weIs11[unc-119(+) + TAC-1::GFP].
JC182 C. elegans unc-52(ut111)/unc-52(e444) II. Show Description
Heterozygotes are slow (weak) Uncs and segregate paralyzed Uncs and early larval lethals. Dead larvae (ut111 homozygotes) are short, 2-fold and have an irregular shape.
JC2749 C. elegans flr-4(ut3) X; utEx33. Show Description
utEx33 [flr-1p::GFP + rol-6(su1006)]. Pick Rollers to maintain. GFP is localized exclusively to intestinal nuclei because of the nuclear localization signal and lack of FLR-1 membrane spanning domains. Reference: Take-uchi et al.: Proc Natl Acd Sci USA. 1998 Sep 29;95(20):11775-80, Take-uchi et al.: Mol Biol Cell. 2005 Mar;16(3):1355-65, Kobayashi et al.: Genes to Cells 2011 May;16(5):565-75.
JC55 C. elegans flr-1(ut11) X. Show Description
Resistant to 400ug/ml NaF. Slow growth. Small brood size. Small and thin.
JCB426 C. elegans chil-11(bet66) IV. Show Description
Homozygous viable. Deletion of 2532 bp in parental strain N2. Left flanking sequence: agtcaattcggaactccatgt; Right flanking sequence: tctacggtttaaacaactcctc. sgRNA #1: aacgggatctgttcatcaca; sgRNA #2: agtgtgaaacgcaacgtcta.
JCP152 C. elegans dpy-11(e224) ccz-1(t2129) V; jcpEx2. Show Description
jcpEx2 [ced-1p::F58G11.6(genomic)::YFP::let-858 3'UTR + unc-119(+) + myo-2::GFP]. Maintain by picking GFP+. Individuals that lost the array produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
JCP169 C. elegans dpy-11(e224) ccz-1(t2129) V; jcpEx3. Show Description
jcpEx3 [ccz-1p::ccz-1(genomic)::YFP::let-858 3'UTR + unc-119(+) + pha-1(+)]. Array rescues lethality. Individuals that lost the array produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
JCP511 C. elegans Show Description
Temperature sensitive
JCP53 C. elegans dpy-11(e224) ccz-1(t2129) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ccz-1 homozygotes (produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
JDW182 C. elegans bmdSi15 lmn-1(wrd39[lmn-1::1xGFP11]) I. Show Description
bmdSi15 [loxN + eef-1A.1p::GFP(1-10)::unc-54 3′ UTR + let-858 terminator + myo-2p::mCherry::3xHA::tbb-2 3′ UTR + loxP] I. bmdSi15 is a CRISPR-based integration into the ttTi4348 site (I:-5.32). Somatic expression of sfGFP(1-10) driven by the eft-3 promoter. GFP11 tag inserted into endogenous lmn-1 locus via CRISPR/Cas9 insertion into parental strain DQM104. Reference: Gregory EF, et al. MicroPubl Biol. 2023 Dec 13:2023:10.17912/micropub.biology.001022. doi: 10.17912/micropub.biology.001022. eCollection 2023. PMID: 38152058.
JDW58 C. elegans nhr-25(wrd11[nhr-25::GFP::SEC::degron:3xFLAG]) X. Show Description
GFP::AID*::3xFLAG tag inserted at the C-terminus of the endogenous nhr-25 locus by CRISPR. Allele obtained using the self-excising casstte, following Dickinson et al, 2015 method. Reference: Martinez MAQ, et al. G3 (Bethesda). 2020 Jan 7;10(1):267-280. doi: 10.1534/g3.119.400781. PMID: 31727633.
JDW628 C. elegans nhr-85(wrd29[nhr-85::GFP::AID*::3xFLAG]) I. Show Description
GFP::AID*::3xFLAG tag inserted at the C-terminus of the endogenous nhr-85 locus using CRISPR self-excising casstte (Dickinson et al, 2015 method). Reference: Myles KM, et al. MicroPubl Biol. 2023 Oct 18:2023:10.17912/micropub.biology.000993. doi: 10.17912/micropub.biology.000993. eCollection 2023. PMID: 37927911.
JDW779 C. elegans cpz-2(wrd297 wrd311[cpz-2::mScarlet::2xOLLAS]) V. Show Description
linker::mScarlet::2xOLLAS::linker inserted at the C-terminus of the endogenous cpz-2 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd297.
JDW894 C. elegans cpz-1(wrd128 wrd379[cpz-1::internal mScarlet::2xOLLAS]) I. Show Description
Superficially wild type. Linker::mScarlet::2xOLLAS::linker inserted internally, to produce a translational fusion 11 amino away from the C-terminus of the endogenous cpz-1 locus by CRISPR using a Cas9 RNP. Allele obtained by replacing a modular mNeonGreen::3xFLAG cassette from wrd128.
JDW979 C. elegans col-61(wrd415[col-61::3xGFP11::3xFLAG]) I; wrdSi142 II. Show Description
wrdSi142 [loxP eft-3p::ssGFP1-10:::ubl-1 3'UTR FRT3] II. ssGFP1-10 contains an N-terminal signal sequence from OIG-1. Modular linker::3xGFP11::3xFLAG::linker tag inserted at the C-terminus of the endogenous col-61 locus by CRISPR. Allele obtained using Cas9 RNP. Cassette design allows for re-editing of locus with common crRNAs/sgRNAs. Derived by sequential edits of parental strain NM5546: wrdSi133 was an insertion into jsSi1726, and subsequent excision left wrdSi142 [loxP::eft-3p::ssGFP1-10::ubl-1 3'UTR::FRT3] inserted at the former jsSi1726 site.
JH2078 C. elegans unc-119(ed3) III; axIs1504. Show Description
axIs1504 [pie-1p::LAP::mex-5::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2108 C. elegans unc-119(ed3) III; axIs1522. Show Description
axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2223 C. elegans unc-119(ed3) III; axIs1611. Show Description
axIs1611 [pie-1p::GFP::histone H2B::daz-1 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2311 C. elegans unc-119(ed3) III; axIs1668. Show Description
axIs1668 [pie-1p::GFP::histone H2B::spn-4 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2317 C. elegans unc-119(ed3) III; axIs1674. Show Description
axIs1674 [pie-1p::GFP::histone H2B::spe-11 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.
JH2330 C. elegans unc-119(ed3) III; axIs1488; axIs????. Show Description
axIs1488 [pie-1p::mCherry::patr-1::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. axIs??? [nmy-2p::pgl-1::GFP::patr-1::nmy-2 3'UTR]. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2773 C. elegans unc-119(ed3) III; axIs1946. Show Description
axIs1946 [pie-1p::Dendra::pgl-1::pgl-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2787 C. elegans pptr-1(tm3103) V. Show Description
pptr-1(tm3103) is a temperature-sensitive allele. Maintain at 15C. Fully penetrant P granule partitioning defect at 20-24C. Low penetrance of sterilty observed at 24-26C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2791 C. elegans pptr-1(tm3103) V; axIs1448. Show Description
axIs1448 [pie-1p::GFP::H2B::nos-2(wt) 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2794 C. elegans pptr-1(tm3103) V; axIs1462. Show Description
axIs1462 [pie-1p::GFP::pie-1::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2835 C. elegans pptr-1(tm3103) V; axIs1504. Show Description
axIs1504 [pie-1p::LAP::mex-5::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2836 C. elegans unc-119(ed3) III; axIs????. Show Description
axIs??? [nmy-2p::pgl-1::GFP::patr-1::nmy-2 3'UTR]. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2838 C. elegans par-1(zu310) V; axIs????. Show Description
axIs??? [nmy-2p::pgl-1::GFP::patr-1::nmy-2 3'UTR]. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2839 C. elegans pptr-1(tm3103) V; axIs1522; axIs1929. Show Description
axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. axIs1929 [pie-1p::mCherry::par-2::pie-1 3'UTR + unc-119(+)]. Transgenes are prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2840 C. elegans unc-119(ed3) III; axIs???? ; axIs1731. Show Description
axIs??? [nmy-2p::pgl-1::GFP::patr-1::nmy-2 3'UTR]. axIs1731 [pie-1p::mCherry::mex-5::pie-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2841 C. elegans pptr-1(tm3103) V; axIs1522. Show Description
axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2842 C. elegans unc-119(ed3) III; ltIs37 IV; axIs1522. Show Description
ltIs37 [(pAA64) pie-1p::mCherry::his-58 + unc-119(+)] IV. axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH2843 C. elegans ltIs37 IV; pptr-1(tm3103) V; axIs1522. Show Description
ltIs37 [(pAA64) pie-1p::mCherry::his-58 + unc-119(+)] IV. axIs1522 [pie-1p::GFP::pgl-1::pgl-1 3'UTR + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C.Reference: Gallo CM, et al. Science. 2010 Dec 17;330(6011):1685-9.
JH3006 C. elegans mus-101(ax2011) I; mbk-2(dd5) IV. Show Description
Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH3011 C. elegans cdc-37(ax2001) II; unc-119(ed3) orIs1 III; mbk-2(dd5) IV. Show Description
orIs1 [pie-1p::GFP::mei-1 + unc-119(+)] III. Maintain at 25C. Suppressor of dd5. Reference: Wang Y, et al. G3 (Bethesda). 2014 Feb 19;4(2):231-41.
JH4201 C. elegans npp-11(ax4547[npp-11::wrmScarlet]) I. Show Description
wrmScarlet is inserted at the C-terminus of the endogenous npp-11 locus. Reference: Thomas et al. 2022. Cytoplasmic nucleoporin foci are stress-sensitive, non-essential condensates in C. elegans
JH4484 C. elegans npp-11(4585[npp-11::AID*::3xFLAG]) I. Show Description
AID*::3xFLAG tags inserted at C-terminus of endogenous npp-11 locus. AID* is a minimal AID construct of 44 amino acids (https://academic.oup.com/genetics/article/217/3/iyab006/6104563). Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."
JIM113 C. elegans ujIs113 II. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. Reference: Zacharias A, et al. PLoS Genet. 2015 Oct 21;11(10):e1005585.
JIM173 C. elegans unc-119(tm4063) III; ujEx173. Show Description
ujEx173 [ceh-36::TY1::EGFP::3xFLAG + unc-119(+)]. Pick non-Unc to maintain. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
JIM220 C. elegans ujIs113 II; unc-30(ok613) IV; ceh-36(ok795) X; ujEx173. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujEx173 [ceh-36::TY1::eGFP::3xFLAG + unc-119(+)]. ujEx173 rescues unc-36, suppressing synthetic lethality in animals carrying the array. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
JIN810 C. elegans agIs26. Show Description
agIs26 [clec-60p::GFP + myo-2p::mCherry]. mCherry expression in pharynx. GFP expression in posterior gut is upregulated during S. aureus infection and at temperatures >15C. [NOTE: This strain has also been described as AU185 in publications.] Reference: Irazoqui JE, et al. Proc Natl Acad Sci U S A. 2008 Nov 11;105(45):17469-74. (PMID: 18981407)
JJ1079 C. elegans hmr-1(zu389)/lin-11(n566) unc-75(e950) I. Show Description
Heterozygotes are WT and segregate WT, Hmr inviable embyros and Egl Unc. Hmr: Hammerhead - defective hypodermal enclosure, especially in anterior regions; approximately 2% of zu389 embryos enclose normally and are Hmp [Humpback: defective body elongation, abnormal bulges on dorsal side]. See also WBPaper00005031. Received new stock from Allison Lynch in the Hardin lab 3/2009.
JJ1508 C. elegans unc-119(ed3) III; zuIs60. Show Description
zuIs60 [pie-1p::GFP(secreted) + unc-119(+)]. Maternally-expressed secreted GFP fills spaces between embryonic cells, and space between embryo and vitelline membrane. Useful marker for vizualizing intercellular spaces in embryos. Reference: Wehman AM, et al. Curr Biol. 2011 Dec 6;21(23):1951-9.
JJ746 C. elegans +/nT1 IV; apx-1(zu183) dpy-11(e224)/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Dpy, Vul and dead eggs. The Dpys give only dead eggs. apx-1 is a maternal effect lethal. zu183 is recessive.
JJ862 C. elegans hmp-1(zu278)/daf-11(m84) sma-1(e30) V. Show Description
Heterozygotes are WT and segregate WT, Hmp inviable embyros (Hmp: humpback-defective body elongation, abnormal bulges on dorsal side) and Daf Sma (ts Daf).