Search Strains

Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. q1011 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2 derived by modification of parental strain JK5810 fbf-2(q945[3xFLAG::fbf-2]) II. q1228 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK5984.

GSS linker and 3xV5 tag inserted at C-teminus of endogenous let-711 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

q1242 is an engineered TGT to ACA substitution in FBEa1 of the endogenous gld-1 locus with a downstream G to C substitution to facilitate screening by restriction digest. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H326A, Y479A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.

1xV5 tag inserted at N-teminus of endogenous daz-1 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

q1257 is an engineered TGT to ACA substitution in FBEb of the endogenous gld-1 locus. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

1xV5 tag inserted at N-teminus of endogenous ife-3 locus. Generated in N2 background. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

Engineered TGT to ACA substitutions in FBEa1 and FBEb of the endogenous gld-1 locus with a downstream G to C substitution to facilitate screening by restriction digest. Pick GFP+ to maintain. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP q1271 homozygotes (sterile Mog). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived by modification of gld-1(q1242) homozygotes from parental strain JK6540. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

rajSi50 [gld-1p::GFP::H2B::gld-1 3'UTR + Cbr-unc-119(+)] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. GFP is visible in germline nuclei, low in distal germ cells, increases proximally, strong in oocytes. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa: slc314 GTCACCAAGTACACTTCCAGCAAG / slc311 TGGCAACATGATGTATGGCACA (100 bp band in FBEa wt). FBEb: slc314 GTCACCAAGTACACTTCCAGCAAG / slc304 GGGTTAGCGTTAAGATAACACA (~500 bp band in FBEb wt). References: Theil K, et al. Nature Commun. 2019 Sep 16;10(1):4205. doi: 10.1038/s41467-019-12050-7. PMID: 31527589. Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

3xFlag tag inserted into endogenous fbf-2 locus with engineered (S453A H454A E457A Y479A) substitutions.

Overall healthy but reduced brood size and pharyngeal pumping rate. Synthetic lethal with emr-1(-). ca19 is a Leu to Arg mutation at position 16 of LEM-2, reconstituting a mutation in the American Hutterite Population that causes juvenile cataracts and premature cardiomyopathy.

GFP and 3xFLAG tags inserted into endgonenous ergo-1 locus; specifically tags a-isoform. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013

GFP and 3xFLAG tags inserted into endgonenous wago-11 locus. Reference: Seroussi U, et al. bioRxiv 2022.08.08.502013; doi: https://doi.org/10.1101/2022.08.08.502013

Mos1 insertion. Salt chemotaxis learning defective. Reference: Proc Natl Acad Sci U S A. 2011 May 3;108(18):7589-94.

1953 bp deletion. Salt chemotaxis learning defective. Reference: Proc Natl Acad Sci U S A. 2011 May 3;108(18):7589-94.

peIs1095 [gcy-7p::ChR2Y2::Venus + unc-122::mCherry]. ChR2Y2 expression in ASEL. Reference: Wang L, et al. J Neurosci, 2017. 37(8): p. 2097-2111. PMID: 28126744

Chemotaxis abnormality, developmental delay, small brood size.  pe420 is a 22 bp deletion in exon 1.

daf-2(pe2722) is a daf-2c-isoform specific mutation. pe2722 is a CRISPR/Cas9-engineered 41 bp deletion (ggttgatgacgatgatgagcccggcggcaggaggcagtgagcaaca) in daf-2 exon 11.5. Guide RNA sequence: gacgatgaagagcccggcgg. Reference: Nagashima T, et al. PLoS Genet. 2019 Jul 19;15(7):e1008297. PMID: 31323047

qjIs11 [glr-1p::SVNLS2::TagBFPsyn + ser-2(prom2)::SVNLS2::TagBFPsyn]. peIs3042 [eat-4p::svnls2::TagRFP675syn + lin-44p::GFP]. peIs2100 [H-20p::NLS4::mCherry]. qjIs14 [H20p::NLS::YC2.60]. Suitable for whole-brain calcium imaging. mCherry and YC2.60 expression in almost all head neurons. BFP and RFP are also expressed to annotate neurons. H20p is a pan-neuronal promoter expressed in almost all neurons, GLR glial cells, XXX hypodermal cells, pharyngeal gland cells and HMC cells. Reference: Toyoshima Y et al. BMC Biol. 2020 Mar 19;18(1):30. PMID: 32188430; Shioi G, et al. Genetics. 2001 Apr;157(4):1611-22. PMID: 11290717.

Deletion flanking sequence (X: 764793) AGTCAACTACTAAAAAACGT-TTTTTTT-TTTTTTCAAATTCTAGAATAAGTT (X:765504). 667 BP DELETION. 7 T insertion.

peIs785 [casy-1p::daf-2 E11-E11.5(+c)-E12::EGFP + casy-1p::daf-2 E11-E11.5(+c)-E12(-c)::mRFP]. peIs785 caries a daf-2 splicing reporter expressed in many neurons. Reference: Tomioka M, et al. Nat Commun. 2016 May 20;7:11645. PMID: 27198602

dotSi100 [T06E6.2 + unc-119(+)] II. Single copy Mos insertion. Suppresses mdf-1(gk2) sterility. Maintain under normal conditions. References: Tarailo-Graovac M, et al. Cell Cycle. 2010 Dec 15;9(24):4858-65. Tarailo-Graovac M, Chen N. G3 (Bethesda). 2012 Aug;2(8):865-71.

dotSi110 [T06E6.2 + unc-119(+)] IV. Single copy Mos insertion. Suppresses mdf-1(gk2) sterility. Maintain under normal conditions. References: Tarailo-Graovac M, Chen N. G3 (Bethesda). 2012 Aug;2(8):865-71.

vxEx277 [mec-3p::ICE + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx277 expresses a human cell death caspase (ICE) to ablate six touch neurons (ALML, ALMR, AVM, PLML, PLMR, and PVM), FLP, and PVD. Reference: Russell J, et al. Proc Natl Acad Sci U S A. 2014 Jun 3;111(22):8269-74.

vxEx282 [WRM0621dC07 + unc-122p::GFP]. Pick GFP+ to maintain. GFP expression in coelomocytes. Fosmid rescues ok415. Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

vxEx470 [asic-1p::mCherry]. Reporter construct contains 7.5 kb 5' promoter region. Pick animals with red fluorescence in neurons to maintain. Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

vxEx283 [mec-10p::asic-1(+) + unc-122p::GFP]. Array rescues asic-1(lf) in ALMl, ALMR, AVM, PLML, PLMR, FLP, and PVD. Pick GFP+ animals to maintain. Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

vxEx284 [sto-5p::asic-1(+) + unc-122p::GFP]. Array rescues asic-1(lf) in FLP and BDU neurons. Pick GFP+ animals to maintain. Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

vxEx478 [sto-5p::asic-1(+) + unc-122p::GFP]. Array rescues asic-1(lf) in FLP and BDU neurons. Pick GFP+ animals to maintain. Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

vxEx105 [dat-1p::ChR2::mCherry + myo-2p::mCherry]. Raise on retinal for optogenetic manipulations (per Vidal-Gadea, 2011). Not necessary for survival. Reference: Vidal-Gadea A, et al. Proc Natl Acad Sci U S A. 2011 Oct 18;108(42):17504-9.

vxEx280 [sto-5p::ICE + gcy-8::ICE + myo-2p::mCherry]. Pick mCherry+ animals to maintain. Genetic ablation of AFDL, AFDR, FLPL, FLPR, BDUL, and BDUR via expression of a human cell death caspase (ICE). Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

vxEx280 [sto-5p::ICE + gcy-8::ICE + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Genetic ablation of AFD, FLP, and BDU via expression of a human cell death caspase (ICE). Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

vxEx540 [tax-4(fosmid) + unc-122p::GFP]. Pick animals with GFP expression in coelomocytes to maintain array. This strain rescues tax-4 function with fosmid WRM069cE04 that includes full tax-4 genomic DNA. Reference: Russell J, et al. Proc Natl Acad Sci U S A. 2014 Jun 3;111(22):8269-74.

vxEx280 [sto-5p::ICE + gcy-8::ICE + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Genetic ablation of AFD, FLP, and BDU via expression of a human cell death caspase (ICE). Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

vxEx582 [gcy-8p::ICE + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Genetic ablation of AFD via expression of a human cell death caspase (ICE). Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

vxIs601 [egl-1p::mCherry::egl-1 3'UTR + unc-122p::GFP]. Transcriptional reporter for apoptotic trigger egl-1. mCherry expression in URX adult neurons and apoptotic cells. Reference: Cohn J, et al. G3 (Bethesda). 2019 Nov 5;9(11):3703-3714. doi: 10.1534/g3.119.400654. PMID: 31519744.

vxEx611 [mtq-2p::mCherry::unc-54 UTR + unc-122p::GFP]. Pick mCherry+/GFP+ to maintain. mCherry is expressed in ventral cord neurons and most head neurons. Reference: Nordquist, S.K., Smith, S.R., and Pierce, J.T. (2018) G3: Genes|Genomes|Genetics, g3.200019.2018. http://doi.org/10.1534/g3.118.200019.

Heterozygotes are WT and segregate WT, RolUncs and dead eggs. Homozygous wDf1 embryos arrest uniformly as unenclosed balls of differentiated cells. wDf2 formerly called zen-1(w1). sc8 previously called rol-4(sc8).

Heterozygotes are WT and segregate WT, DpyUncs and dead eggs. Homozygous wDf1 embryos arrest uniformly as unenclosed balls of differentiated cells. wDf1 formerly called zen-1(e2482). 2/02: dpy-21 appears to have been lost from this strain.

Halicephalobus mephisto wild isolate. Grow at 37C: can survive higher temperatures than C. elegans. Useful model organism for studying heat tolerance; has expanded Hsp70 and AIG1 gene families. Has approximately 1.15% snp heterozygosity. Parthenogenetic reproduction so it cannot be out-crossed. References: Borgonie G, et al. Nature. 2011 Jun 2;474(7349):79-82. Weinstein DJ, et al. Nat Commun. 2019 Nov 21;10(1):5268.

Heterozygotes are WT and segregate WT, Dpy Stu, Unc-36 (eT1 homozygotes) and dead eggs. Also weak Him.

Long defecation cycle period. Slightly slow growing and scrawny.

Hid.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Endogenous hsf-1 tagged with the auxin-inducible-degron (AID*) and GFP allows depletion of endogenous HSF-1 in the somatic tissues upon auxin treatment. Animals treated with 1mM of auxin when eggs are laid will arrest in L1 or L2 stage. Reference: Edwards SL, et al. Cell Rep. 2021 Aug 31;36(9):109623. PMID2021 Aug 31;36(9):109623. PMID: 34469721

Male-female strain. Isolated by Marie-Anne Felix from decomposing fruit and vegetables sampled on March 11, 2007, in small vegetable gardens in Okazaki (East of Nagoya), Aichi Prefecture, Japan. Isofemale line. Maintain by mating.

Caenorhabditis sp. 11 Isolated by Marie-Anne Felix from rotting torch ginger (Etlingeria elatior) flowers sampled in the island of La Réunion by Valérie Robert and Loïc Sablé in Jan 2008. Hermaphrodite. Culture at 20°C or above. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis sp. 12 Male-female strain. Isolated in Nouragues, French Guiana. Reference: Kiontke KC, et al. BMC Evol Biol. 2011 Nov 21;11:339.

Caenorhabditis sp. 11 Isolated by Marie-Anne Felix from rotting Duguetia surinamensis fruit, sampled by Patrick Châtelet on the "Petit Plateau" in the Nouragues Forest, French Guyana in May 2008. Hermaphrodite. Culture at 20°C or above. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Isolated from rotting palm fruit sampled by MAF on 9 June 2008 in the Park Guëll, Barcelona, Spain. Picked as young adult on 11 June 2008. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).

Caenorhabditis sp. 18 Male-female strain. Isolated in Nouragues, French Guiana. Reference: Kiontke KC, et al. BMC Evol Biol. 2011 Nov 21;11:339.