Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
AH159 C. elegans sra-13(zh13) II. Show Description
sra-13(zh13) mutants display stronger chemotaxis to limiting concentrations of isoamylalcohol and diacetyl than WT animals. Deletion allele. 396 bp of 5' promoter sequence and all but the last exon are removed; probably a null allele.
AX1410 C. elegans flp-18(db99) X. Show Description
Impaired chemotaxis and foraging behavior. Excess intestinal fat accumulation. Reduced oxygen consumption. Derived from NL4000. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.
BB19 C. elegans adr-1(tm668) I. Show Description
Reduced lifespan, chemotaxis defective, co-suppression of transgenes in somatic cells. Maintain under normal conditions. Reference: Hundley HA, et al. RNA. 2008 Oct;14(10):2050-60.
BB2 C. elegans adr-1(gv6) I. Show Description
Defective chemotaxis to volatile odorant. Low percentage (about 6%) have protruding vulva.
BB21 C. elegans adr-1(tm668) I; adr-2(ok735) III. Show Description
Reduced lifespan, chemotaxis defective, co-suppression of transgenes in somatic cells. Maintain under normal conditions. Reference: Hundley HA, et al. RNA. 2008 Oct;14(10):2050-60.
BB239 C. elegans adr-1(uu49) I; adr-2(uu28) III. Show Description
Chemotaxis deficient. Transgenes are silenced in this background. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282. NOTE: In the referenced publication, irregularities were noted in the adr-1(gv6);adr-2(gv42) null strain, which were ascribed to background mutationsint hat strain. This strain -- adr-1(uu49);adr-2(uu28) -- was generated Crispr/Cas9 targeted mutation and phenotypes are more consistent with another null strain, adr-1(tm668);adr-2(ok735).
BB3 C. elegans adr-2(gv42) III. Show Description
Defective chemotaxis to volatile odorant.
BB4 C. elegans adr-1(gv6) I; adr-2(gv42) III. Show Description
Defective chemotaxis to volatile odorant. Low percentage (about 6%) have protruding vulva.
CB1033 C. elegans che-2(e1033) X. Show Description
Chemotaxis abnormal. Amphid defect-EM. M-MATING-NO SUCCESS
CB1034 C. elegans che-1(e1034) fer-1(hc1) I. Show Description
Chemotaxis abnormal. Temperature sensitive fertilization defective. Maintain at 15C. M-MATING+++ 10-30%WT.
CB1073 C. elegans che-5(e1073) IV. Show Description
Unc. Chemotaxis abnormal. Short. Variable Dpyish. M-MATING++ 1-10%WT.
CB1124 C. elegans che-3(e1124) I. Show Description
Chemotaxis abnormal. Crawls off plate. Dauer defective. Small. M-MATING-NO SUCCESS.
CB1125 C. elegans mor-2(e1125) IV. Show Description
Chemotaxis abnormal. Rounded head.
CB1126 C. elegans che-6(e1126) IV. Show Description
Chemotaxis defective: Cl-. Dauer recovery slow. Movement almost wild-type. Recessive. M-MATING+++ 10-30%WT.
CB1128 C. elegans che-7(e1128) V. Show Description
Chemotaxis defective: Cl-. Eggs laid off bacteria. Small. Recessive. M-MATING+++ 10-30%WT.
CB1375 C. elegans daf-18(e1375) IV. Show Description
Dauer defective. Non-crowder. Chemotaxis normal.
CB1377 C. elegans daf-6(e1377) X. Show Description
Dauer defective. Crowds. Leaky. Dauer recovery normal. Chemotaxis defective-Na+. M-MATING++++ >30%WT.
CB1379 C. elegans che-3(e1379) I. Show Description
Dauer defective. Crowds. Chemotaxis defective-Na+. M-MATING-NO SUCCESS.
CB1387 C. elegans daf-10(e1387) IV. Show Description
Amphid defect. Chemotaxis defective (Na+). Crowds. Dauer defective. Very leaky. M-MATING+POOR <1%WT.
CB1393 C. elegans daf-8(e1393) I. Show Description
Dauer constitutive. Temperature sensitive. Crowds. Chemotaxis normal. Grow at 15C.
CB6038 C. elegans tax-4(e2861) III. Show Description
Chemotaxis-defective; partly resistant to bacterial infection by Microbacterium nematophilum (Bus phenotype) and Leucobacter Verde2; abnormal surface. Reference: Yook & Hodgkin (2007) PMID: 17151260.
CL2355 C. elegans smg-1(cc546) dvIs50 I. Show Description
dvIs50 [pCL45 (snb-1::Abeta 1-42::3' UTR(long) + mtl-2::GFP] I. Maintain at 16C. Pan-neuronal expresion of human Abeta peptide. Constitutive intestinal expression of GFP from marker transgene. Strain shows deficits in chemotaxis, associative learning, and thrashing in liquid. Strain also has incomplete sterility due to germline proliferation defects and embryonic lethality. Maintain at 16 C to reduce selection against transgene, although this does not alter the partial sterility. Reference: Wu Y., et al. J Neurosci. 2006 Dec 13;26(50):13102-13. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
CX2065 C. elegans odr-1(n1936) X. Show Description
Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. [NOTE: the n1936 mutation is a G-to-A substitution at the end of the second exon (donor site). N2: 5'AGTTGAGGTAATTCA3'. n1936: 5'AGTTGAGATAATTCA3'. Recommended sequencing primers: FWD 5'gcaggagctcacatcggtta3'; REV 5'ttggaatcacatcctgcatga3'.]
CX2205 C. elegans odr-3(n2150) V. Show Description
Defective chemotaxis to many volative odorants. Defective osmotic avoidance (osm). Defective chemotaxis to some water-soluble attractants (che).
CX2304 C. elegans odr-2(n2145) V. Show Description
Defective chemotaxis to some volatile odorants: benzaldehyde, isoamyl alcohol.
CX2357 C. elegans odr-5(ky9) X. Show Description
Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. Linked sterility has not been separated from Odr phenotype.
CX32 C. elegans odr-10(ky32) X. Show Description
Impaired chemotaxis to low concentrations of the odorant diacetyl.
CX3410 C. elegans odr-10(ky225) X. Show Description
Impaired chemotaxis to low concentrations of the odorant diacetyl. ky225 is a 1351 bp deletion removing all coding sequence past the N-terminal 120 amino acids.
DCR5037 C. elegans inx-1(ola278) X; olaEx2986. Show Description
olaEx2986 [ttx-3p::SL2::nCRE::unc-54 3'UTR + unc-122::RFP]. Pick animals with RFP+ expression in coelomocytes to maintain. Isothermal tracking phenotype during thermotaxis. inx-1(ola278) is an engineered floxed allele of inx-1 allowing conditional knockdown using Cre recombinase. Reference: Almoril-Porras A, et al. Cell. 2025 Jan 9;188(1):89-103.e13. doi: 10.1016/j.cell.2024.11.037. PMID: 39742807.
DR25 C. elegans daf-12(m25) X. Show Description
Dauer defective. Class 2 suppressor of dauer constitutives. Chemotaxis normal. See also WBPaper00002149. [Previously called daf-20.]
DR27 C. elegans daf-16(m27) I. Show Description
Dauer defective. Chemotaxis normal. Class 2 suppressor of dauer constitutive.
DR292 C. elegans che-3(e1379) I; him-8(e1489) IV. Show Description
Dauer defective. Segregates males. Chemotaxis defective (Na+).
DR47 C. elegans daf-11(m47) V. Show Description
Temperature sensitive. Leaky at 25C. Dauers recover poorly at 15C. Dauers escape plates. Recessive. Chemotaxis defective (Na+). Received new stock from Riddle lab in November 2006.
DR77 C. elegans daf-14(m77) IV. Show Description
Temperature sensitive dauer constitutive. Tight at 25C. Leaky at 15C. Chemotaxis normal.
EU1068 C. elegans unc-119(ed3) ruIs32 III; repo-1 (or430) IV; ruIs57. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C; viable at permissive temperature of 15C. Reversed AP polarity axis at restrictive temperature with his-11::GFP and tubulin::GFP expression. Reference: Keikhaee MR, et al. PLoS One. 2014 Sep 4;9(9):e106484.
EU2858 C. elegans repo-1(or430) IV; itIs153; ojIs1. Show Description
itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C; viable at permissive temperature of 15C. Reversed AP polarity axis at restrictive temperature with par-2::GFP and tubulin::GFP expression. itIs153 is an integrated derivitive of axEx1094. Reference: Keikhaee MR, et al. PLoS One. 2014 Sep 4;9(9):e106484.
FK134 C. elegans ttx-3(ks5) X. Show Description
Abnormal in thermotaxis. Cryophilic (cold-seeking) and abnormal in isothermal tracking.
FK311 C. elegans ceh-36(ks86) X. Show Description
Defective chemotaxis to Na+ and isoamyl alcohol.
IK105 C. elegans pkc-1(nj1) V. Show Description
Thermophilic. Defective chemotaxis to AWA- and AWC- sensed odorants except for partially defective chemotaxis to pyrazine. Defective chemotaxis to NaCl. Defective osmotic avoidance. PKA ttx-4.
IK130 C. elegans pkc-1(nj3) V. Show Description
Thermophilic. Defective chemotaxis to AWA- and AWC- sensed odorants except for partially defective chemotaxis to pyrazine. Partially defective chemotaxis to NaCl. Partially defective osmotic avoidance. PKA ttx-4.
IK174 C. elegans pkc-1(nj4) V. Show Description
Thermophilic. Defective chemotaxis to AWA- and AWC- sensed odorants except for partially defective chemotaxis to pyrazine. Partially defective chemotaxis to NaCl. Partially defective osmotic avoidance. PKA ttx-4.
IK427 C. elegans gcy-23(nj37) IV. Show Description
Nearly normal thermotaxis behavior.
IK429 C. elegans gcy-18(nj38) IV. Show Description
Nearly normal thermotaxis behavior.
IK575 C. elegans ttx-7(nj40) I. Show Description
Weak allele. Severe thermotaxis defect. Weak defects in chemitaxis. Subcellular localization of SNB-1:GFP is abnormal in RIA interneurons.
IK589 C. elegans ttx-7(nj50) I. Show Description
Putative null allele which lacks whole of the first exon of the gene (lacking 361 bp area corresponding to 13460-13820 of the cosmid F13G3). Severe thermotaxis defect. Weak defects in chemitaxis. Subcellular localization of synaptic proteins is abnormal in RIA interneurons.
IK591 C. elegans ttx-7(nj51) I. Show Description
Putative null allele which lacks whole of the 3rd exon of the gene (lacking 260 bp area corresponding to 12984-13243 of the cosmid F13G3). Severe thermotaxis defect. Weak defects in chemitaxis. Subcellular localization of SNB-1::GFP is abnormal in RIA interneurons.
IK597 C. elegans gcy-23(nj37) gcy-8(oy44) gcy-18(nj38) IV. Show Description
Severe defects in thermotaxis.
IK800 C. elegans gcy-8(oy44) IV. Show Description
Nearly normal thermotaxis behavior.
JC1970 C. elegans tbx-2(ut180) III. Show Description
Synthetic dauer-constitutive with unc-31(e169) or unc-3(e151). Defective in adaptation to benzaldehyde, isoamyl alcohol, and butanone. Normal in adaptation to diacetyl and 2-methylpyrazine. Normal in chemotaxis to volatile and water-soluble chemicals.
JC1971 C. elegans tbx-2(ut192) III. Show Description
Synthetic dauer-constitutive with unc-31(e169) or unc-3(e151). Defective in adaptation to benzaldehyde, isoamyl alcohol, and butanone. Normal in adaptation to diacetyl and 2-methylpyrazine. Normal in chemotaxis to volatile and water-soluble chemicals.