AH159 |
C. elegans |
sra-13(zh13) II. Show Description
sra-13(zh13) mutants display stronger chemotaxis to limiting concentrations of isoamylalcohol and diacetyl than WT animals. Deletion allele. 396 bp of 5' promoter sequence and all but the last exon are removed; probably a null allele.
|
|
AX1410 |
C. elegans |
flp-18(db99) X. Show Description
Impaired chemotaxis and foraging behavior. Excess intestinal fat accumulation. Reduced oxygen consumption. Derived from NL4000. Reference: Cohen M, et al. 2009 Cell Metabolism 9: 375-385.
|
|
BB19 |
C. elegans |
adr-1(tm668) I. Show Description
Reduced lifespan, chemotaxis defective, co-suppression of transgenes in somatic cells. Maintain under normal conditions. Reference: Hundley HA, et al. RNA. 2008 Oct;14(10):2050-60.
|
|
BB2 |
C. elegans |
adr-1(gv6) I. Show Description
Defective chemotaxis to volatile odorant. Low percentage (about 6%) have protruding vulva.
|
|
BB21 |
C. elegans |
adr-1(tm668) I; adr-2(ok735) III. Show Description
Reduced lifespan, chemotaxis defective, co-suppression of transgenes in somatic cells. Maintain under normal conditions. Reference: Hundley HA, et al. RNA. 2008 Oct;14(10):2050-60.
|
|
BB239 |
C. elegans |
adr-1(uu49) I; adr-2(uu28) III. Show Description
Chemotaxis deficient. Transgenes are silenced in this background. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282. NOTE: In the referenced publication, irregularities were noted in the adr-1(gv6);adr-2(gv42) null strain, which were ascribed to background mutationsint hat strain. This strain -- adr-1(uu49);adr-2(uu28) -- was generated Crispr/Cas9 targeted mutation and phenotypes are more consistent with another null strain, adr-1(tm668);adr-2(ok735).
|
|
BB3 |
C. elegans |
adr-2(gv42) III. Show Description
Defective chemotaxis to volatile odorant.
|
|
BB4 |
C. elegans |
adr-1(gv6) I; adr-2(gv42) III. Show Description
Defective chemotaxis to volatile odorant. Low percentage (about 6%) have protruding vulva.
|
|
CB1033 |
C. elegans |
che-2(e1033) X. Show Description
Chemotaxis abnormal. Amphid defect-EM. M-MATING-NO SUCCESS
|
|
CB1034 |
C. elegans |
che-1(e1034) fer-1(hc1) I. Show Description
Chemotaxis abnormal. Temperature sensitive fertilization defective. Maintain at 15C. M-MATING+++ 10-30%WT.
|
|
CB1073 |
C. elegans |
che-5(e1073) IV. Show Description
Unc. Chemotaxis abnormal. Short. Variable Dpyish. M-MATING++ 1-10%WT.
|
|
CB1124 |
C. elegans |
che-3(e1124) I. Show Description
Chemotaxis abnormal. Crawls off plate. Dauer defective. Small. M-MATING-NO SUCCESS.
|
|
CB1125 |
C. elegans |
mor-2(e1125) IV. Show Description
Chemotaxis abnormal. Rounded head.
|
|
CB1126 |
C. elegans |
che-6(e1126) IV. Show Description
Chemotaxis defective: Cl-. Dauer recovery slow. Movement almost wild-type. Recessive. M-MATING+++ 10-30%WT.
|
|
CB1128 |
C. elegans |
che-7(e1128) V. Show Description
Chemotaxis defective: Cl-. Eggs laid off bacteria. Small. Recessive. M-MATING+++ 10-30%WT.
|
|
CB1375 |
C. elegans |
daf-18(e1375) IV. Show Description
Dauer defective. Non-crowder. Chemotaxis normal.
|
|
CB1377 |
C. elegans |
daf-6(e1377) X. Show Description
Dauer defective. Crowds. Leaky. Dauer recovery normal. Chemotaxis defective-Na+. M-MATING++++ >30%WT.
|
|
CB1379 |
C. elegans |
che-3(e1379) I. Show Description
Dauer defective. Crowds. Chemotaxis defective-Na+. M-MATING-NO SUCCESS.
|
|
CB1387 |
C. elegans |
daf-10(e1387) IV. Show Description
Amphid defect. Chemotaxis defective (Na+). Crowds. Dauer defective. Very leaky. M-MATING+POOR <1%WT.
|
|
CB1393 |
C. elegans |
daf-8(e1393) I. Show Description
Dauer constitutive. Temperature sensitive. Crowds. Chemotaxis normal. Grow at 15C.
|
|
CB6038 |
C. elegans |
tax-4(e2861) III. Show Description
Chemotaxis-defective; partly resistant to bacterial infection by Microbacterium nematophilum (Bus phenotype) and Leucobacter Verde2; abnormal surface. Reference: Yook & Hodgkin (2007) PMID: 17151260.
|
|
CL2355 |
C. elegans |
smg-1(cc546) dvIs50 I. Show Description
dvIs50 [pCL45 (snb-1::Abeta 1-42::3' UTR(long) + mtl-2::GFP] I. Maintain at 16C. Pan-neuronal expresion of human Abeta peptide. Constitutive intestinal expression of GFP from marker transgene. Strain shows deficits in chemotaxis, associative learning, and thrashing in liquid. Strain also has incomplete sterility due to germline proliferation defects and embryonic lethality. Maintain at 16 C to reduce selection against transgene, although this does not alter the partial sterility. Reference: Wu Y., et al. J Neurosci. 2006 Dec 13;26(50):13102-13.
|
|
CX2065 |
C. elegans |
odr-1(n1936) X. Show Description
Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. [NOTE: the n1936 mutation is a G-to-A substitution at the end of the second exon (donor site). N2: 5'AGTTGAGGTAATTCA3'. n1936: 5'AGTTGAGATAATTCA3'. Recommended sequencing primers: FWD 5'gcaggagctcacatcggtta3'; REV 5'ttggaatcacatcctgcatga3'.]
|
|
CX2205 |
C. elegans |
odr-3(n2150) V. Show Description
Defective chemotaxis to many volative odorants. Defective osmotic avoidance (osm). Defective chemotaxis to some water-soluble attractants (che).
|
|
CX2304 |
C. elegans |
odr-2(n2145) V. Show Description
Defective chemotaxis to some volatile odorants: benzaldehyde, isoamyl alcohol.
|
|
CX2357 |
C. elegans |
odr-5(ky9) X. Show Description
Defective chemotaxis to some volatile odorants: benzaldehyde, 2-butanone, isoamyl alcohol. Linked sterility has not been separated from Odr phenotype.
|
|
CX32 |
C. elegans |
odr-10(ky32) X. Show Description
Impaired chemotaxis to low concentrations of the odorant diacetyl.
|
|
CX3410 |
C. elegans |
odr-10(ky225) X. Show Description
Impaired chemotaxis to low concentrations of the odorant diacetyl. ky225 is a 1351 bp deletion removing all coding sequence past the N-terminal 120 amino acids.
|
|
DR25 |
C. elegans |
daf-12(m25) X. Show Description
Dauer defective. Class 2 suppressor of dauer constitutives. Chemotaxis normal. See also WBPaper00002149. [Previously called daf-20.]
|
|
DR27 |
C. elegans |
daf-16(m27) I. Show Description
Dauer defective. Chemotaxis normal. Class 2 suppressor of dauer constitutive.
|
|
DR292 |
C. elegans |
che-3(e1379) I; him-8(e1489) IV. Show Description
Dauer defective. Segregates males. Chemotaxis defective (Na+).
|
|
DR47 |
C. elegans |
daf-11(m47) V. Show Description
Temperature sensitive. Leaky at 25C. Dauers recover poorly at 15C. Dauers escape plates. Recessive. Chemotaxis defective (Na+). Received new stock from Riddle lab in November 2006.
|
|
DR77 |
C. elegans |
daf-14(m77) IV. Show Description
Temperature sensitive dauer constitutive. Tight at 25C. Leaky at 15C. Chemotaxis normal.
|
|
EU1068 |
C. elegans |
unc-119(ed3) ruIs32 III; repo-1 (or430) IV; ruIs57. Show Description
ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C; viable at permissive temperature of 15C. Reversed AP polarity axis at restrictive temperature with his-11::GFP and tubulin::GFP expression. Reference: Keikhaee MR, et al. PLoS One. 2014 Sep 4;9(9):e106484.
|
|
EU2858 |
C. elegans |
repo-1(or430) IV; itIs153; ojIs1. Show Description
itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C; viable at permissive temperature of 15C. Reversed AP polarity axis at restrictive temperature with par-2::GFP and tubulin::GFP expression. itIs153 is an integrated derivitive of axEx1094. Reference: Keikhaee MR, et al. PLoS One. 2014 Sep 4;9(9):e106484.
|
|
FK134 |
C. elegans |
ttx-3(ks5) X. Show Description
Abnormal in thermotaxis. Cryophilic (cold-seeking) and abnormal in isothermal tracking.
|
|
FK311 |
C. elegans |
ceh-36(ks86) X. Show Description
Defective chemotaxis to Na+ and isoamyl alcohol.
|
|
IK105 |
C. elegans |
pkc-1(nj1) V. Show Description
Thermophilic. Defective chemotaxis to AWA- and AWC- sensed odorants except for partially defective chemotaxis to pyrazine. Defective chemotaxis to NaCl. Defective osmotic avoidance. PKA ttx-4.
|
|
IK130 |
C. elegans |
pkc-1(nj3) V. Show Description
Thermophilic. Defective chemotaxis to AWA- and AWC- sensed odorants except for partially defective chemotaxis to pyrazine. Partially defective chemotaxis to NaCl. Partially defective osmotic avoidance. PKA ttx-4.
|
|
IK174 |
C. elegans |
pkc-1(nj4) V. Show Description
Thermophilic. Defective chemotaxis to AWA- and AWC- sensed odorants except for partially defective chemotaxis to pyrazine. Partially defective chemotaxis to NaCl. Partially defective osmotic avoidance. PKA ttx-4.
|
|
IK427 |
C. elegans |
gcy-23(nj37) IV. Show Description
Nearly normal thermotaxis behavior.
|
|
IK429 |
C. elegans |
gcy-18(nj38) IV. Show Description
Nearly normal thermotaxis behavior.
|
|
IK575 |
C. elegans |
ttx-7(nj40) I. Show Description
Weak allele. Severe thermotaxis defect. Weak defects in chemitaxis. Subcellular localization of SNB-1:GFP is abnormal in RIA interneurons.
|
|
IK589 |
C. elegans |
ttx-7(nj50) I. Show Description
Putative null allele which lacks whole of the first exon of the gene (lacking 361 bp area corresponding to 13460-13820 of the cosmid F13G3). Severe thermotaxis defect. Weak defects in chemitaxis. Subcellular localization of synaptic proteins is abnormal in RIA interneurons.
|
|
IK591 |
C. elegans |
ttx-7(nj51) I. Show Description
Putative null allele which lacks whole of the 3rd exon of the gene (lacking 260 bp area corresponding to 12984-13243 of the cosmid F13G3). Severe thermotaxis defect. Weak defects in chemitaxis. Subcellular localization of SNB-1::GFP is abnormal in RIA interneurons.
|
|
IK597 |
C. elegans |
gcy-23(nj37) gcy-8(oy44) gcy-18(nj38) IV. Show Description
Severe defects in thermotaxis.
|
|
IK800 |
C. elegans |
gcy-8(oy44) IV. Show Description
Nearly normal thermotaxis behavior.
|
|
JC1970 |
C. elegans |
tbx-2(ut180) III. Show Description
Synthetic dauer-constitutive with unc-31(e169) or unc-3(e151). Defective in adaptation to benzaldehyde, isoamyl alcohol, and butanone. Normal in adaptation to diacetyl and 2-methylpyrazine. Normal in chemotaxis to volatile and water-soluble chemicals.
|
|
JC1971 |
C. elegans |
tbx-2(ut192) III. Show Description
Synthetic dauer-constitutive with unc-31(e169) or unc-3(e151). Defective in adaptation to benzaldehyde, isoamyl alcohol, and butanone. Normal in adaptation to diacetyl and 2-methylpyrazine. Normal in chemotaxis to volatile and water-soluble chemicals.
|
|
JC2209 |
C. elegans |
olrn-1(ut305) X. Show Description
Butanone enhancement abnormal. Abnormal chemotaxis to x1/1000 butanone. 2AWC-OFF (no expression of str-2::GFP in either of the two AWC neurons. Allelic to nsy-6(ky626).
|
|