Search Strains

qySi148 [lin-29p::2xmKate2::PLCdeltaPH] I. mNeonGreen tag inserted into C-terminus of endogenous lam-2 locus. Superfically wild-type strain with AC-specific plasma membrane marker and BM marker. BM visualized with endogenously tagged laminin. Plasma membrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.

qySi147 [lin-29p::mKate2::PLC(delta)PH] I. qy234 [mNG::sec16A.1] III. sec16A.1 locus endogenously tagged with mNG at the N-terminus and MosSCI single copy insertion for anchor cell specific expression of membrane marker PLC?PH. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.

cpIs91 [lag-2p::2x mKate2::PLC(delta)PH::3xHA::tbb-2 3'UTR LoxN] II. sbp-1 locus endogenously tagged with mNG at the N-terminus. Superficially wild-type. Reference: Park K, et al. J Cell Biol. 2024 Oct 7;223(10):e202402035. PMID: 39007804.

cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II.  mNeonGreen tag inserted into C-terminus of endogenous immt-1 locus. lag-2 driven red plasma membrane marker.

cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II.  mNeonGreen tag inserted into C-terminus of endogenous ucr-2.1 locus. lag-2 driven red plasma membrane marker.

cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II.  mNeonGreen tag inserted into C-terminus of endogenous nduv-2 locus. lag-2 driven red plasma membrane marker.

cpIs91 [lag-2p::2xmKate2::PLCdeltaPH::3xHA::tbb-2 3'UTR LoxN] II.  mNeonGreen tag inserted into C-terminus of endogenous crls-1 locus. lag-2 driven red plasma membrane marker.

qySi313 [lin-29p::ucp-4::SL2::mKate2::PLC(delta)PH::3xHA::tbb-2 3'UTR] I. qyIs629 [eef-1A.1p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Ubiquitous somatic expression of ratiometric ATP:ADP biosensor PercevalHR. Anchor cell specific overexpression of mitochondrial uncoupling protein, UCP-4, (expression confirmed by presence of red anchor cell membrane). qySi313 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.

qySi148 [lin-29p::2xmKate2::PLCdeltaPH] I. qyIs636 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP. Plasma membrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.

Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1598 homozygotes (produce ~100% dead eggs, slightly higher penetrance at 25C). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Peters N, et al., J Cell Sci. 2010 Mar 1;123(Pt 5):795-805.

ocfIs2 [pie-1p:mCherry::sp12::pie-1 3'UTR + unc-119(+)]. Stable germline and embryonic expression of ER and NE marker, useful for following NE dynamics through early development. Reference: Joseph-Strauss D, et al. Dev Biol. 2012 May 15;365(2):445-57.

ocfIs5 [pie-1p::mCherry::npp-1::pie-1 3'UTR + unc119(+)]. Reference: Joseph-Strauss D, et al. Dev Biol. 2012 May 15;365(2):445-57.

ltSi249 [dlg-1p(delta)7::dlg-1::GFP::unc-54 3'UTR Cbr-unc-119(+)] I. ltSi511 [cnd-1p::mCherry::PH::unc-54 3'UTR Cbr-unc-119(+)] II. During embryogenesis epidermal cell junctions fluoresce green and neuronal cell surface fluoresces red. Reference: Wang S, et al. Development. 2019 Apr 11;146(7):dev174029. doi: 10.1242/dev.174029. PMID: 30890570.

ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)].

ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)].

ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. ltIs24 [pAZ132; pie-1::GFP::tba-2 + unc-119(+)].

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: Essex A, et al. Mol Biol Cell. 2009 Feb;20(4):1252-67. doi: 10.1091/mbc.e08-10-1047. Epub 2008 Dec 24. PMID: 19109417

drSi12 [hsf-1p::human hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy human HSF1 (drSi12) in hsf-1(sy441) hypomorph. drSi12 includes human hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the C. elegans hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Larval arrest at 25C. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

drSi13 [hsf-1p::hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy C. elegans HSF-1 (drSi13) in hsf-1(sy441) hypomorph. drSi13 includes hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Moderate rescue of sy441 25C growth arrest, but should be maintained at 20C or lower. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi28 in hsf-1(sy441) hypomorph. drSi28 includes hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain, with a C-terminal GFP and under control of 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Larval arrest at 25C. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

drSi41 [hsf-1p::hsf-1::HA::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi41 in hsf-1(sy441) hypomorph. drSi41 includes hsf-1 cDNA containing an HA tag in frame between amino acids 370 and 371, under control of 4 kb of the hsf-1 promoter, integrated as a single copy by MosSCI on chromosome II at ttTi5605. Moderate rescue of sy441 25C growth arrest, but should be maintained at 20C or lower. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

otIs517 [tph-1(fosmid)::SL2::YFP::H2B + ttx-3::mCherry]. Fosmid-based tph-1 reporter expresses YFP in NSM, ADF, and HSN neurons, as well as in R1B, R3B, and R9B (in males). Adult animals roll, though for reasons unknown.

otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Temperature-senstive daf(c): maintain at 15C. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Constitutive dauer formation at 25 C due to daf-2(e1370). Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

otEx7948 [lgc-8p::mNeonGreen::PH::p10 + pha-1(+)]. I1 neurons are labeled with mNeonGreen. Can be used to isolate I1 neurons by FACS (green-only). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

ot1545 is CRISPR-engineered 2,838 bp deletion removing the entire tph-1 coding region. Sequence after edit: tgtatattacgtgccgaattccagaagcaccacgcccaacacaaagacacgttttcctgcagaagaggaa. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

otIs942 [tph-1(prom5)::daf-2(DN)::eBFP2::SL2::tagRFP-T::tbb-2 3' UTR + unc-122p::GFP::unc-54 3' UTR] V. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. daf-2(DN) encodes a dominant negative form of the DAF-2 protein, causing inhibition of the insulin receptor DAF-2. tph-1(prom5) drives expression of daf-2(DN) specifically in the NSM neurons. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.

otIs908 [pha-4(prom2)::TIR1(F79G)::mTur2::tbb-2 3'UTR + unc-122p::mCherry::unc-54 3' UTR] V. Endogenously-tagged pha-4::GFP::AID crossed with enteric neuron-specific TIR1(F79G), allowing depletion of PHA-4 from pharyngeal nerons, AVL, and RIS by addition of 5-Ph-IAA. Reference: Walker Z, et al. Genes Dev. 2025 Dec 4. doi: 10.1101/gad.353265.125. PMID: 41345038.

zdIs13 [tph-1p::GFP] IV. oyIs14 [sra-6::GFP + lin-15(+)] V.

otIs173[F25B3.3::DsRed2 + ttx-3promB::GFP] III. zdIs13 [tph-1p::GFP] IV.

otIs173[F25B3.3::DsRed2 + ttx-3promB::GFP]. zdIs13 [tph-1p::GFP] IV.

zdIs13 [tph-1p::GFP] IV.

zdIs13 [tph-1p::GFP] IV.

zdIs13 [tph-1p::GFP] IV.

zdIs13 [tph-1p::GFP] IV.

zdIs13 [tph-1p::GFP] IV. otEx3154 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 1.

zdIs13 [tph-1p::GFP] IV. otEx3155 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 2.

zdIs13 [tph-1p::GFP] IV. otEx3156 [dpy-7p::hif-1(p621A) + ttx-3::RFP]. Line 3.

zdIs13 [tph-1p::GFP] IV. otEx3163 [unc-120p::hif-1(p621A) + ttx-3::RFP]. Line 1.

zdIs13 [tph-1p::GFP] IV. otEx3165 [unc-120p::hif-1(p621A) + ttx-3::RFP]. Line 3.

zdIs13 [tph-1p::GFP] IV. otEx3168 [hif-1p::hif-1(p621A) + ttx-3::RFP]. Line 1.

zdIs13 [tph-1p::GFP] IV. otEx3169 [hif-1p::hif-1(p621A) + ttx-3::RFP]. Line 2.

zdIs13 [tph-1p::GFP] IV. otEx3170 [hif-1p::hif-1(p621A) + ttx-3::RFP]. Line 3.

zdIs13 [tph-1p::GFP] IV. otEx3567 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 1.

zdIs13 [tph-1p::GFP] IV. otEx3568 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 2.

zdIs13 [tph-1p::GFP] IV. otEx3569 [ptph-1::hif-1(p621A) + ttx-3::RFP]. Line 3.

Bacteria. Uracil auxotroph. E. coli B. Biosafety Level: BSL-1.

Significant depletion of serotonin and serotonin-derived metabolites; increase in exploration. Double mutant created by CRISPR-mediated deletion of 1450 bp spans Exon 1 to Exon 6 (the same deletion as syb3601 in PHX3601) in tph-1 background. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT.

GFP tag inserted into endogenous pah-1 locus by CRISPR/Cas9.

Endogenous tph-1 locus tagged by CRISPR/Cas9-engineering. Reference: Wang C, et al. Elife. 2024 Oct 18:13:RP95402. doi: 10.7554/eLife.95402. PMID: 39422452.