Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
BE42 C. elegans sqt-3(sc42) V. Show Description
BE63 C. elegans sqt-3(sc63) V. Show Description
Dominant. Heterozygotes are Rollers. Temperature sensitive. At 25C: homozygotes are Sqt; heterozygotes are rollers. AT 16C: homozygotes are WT (a few adults may roll weakly); heterozygotes are WT. M-MATING+LOW TEMP ONLY.
BE8 C. elegans sqt-3(sc8) V. Show Description
Adults and L4 animals roll left. Recessive. M-MATING++ 1-10%WT. PKA rol-4.
CB24 C. elegans sqt-3(e24) V. Show Description
ts
CB4121 C. elegans sqt-3(e2117) V. Show Description
Viable Dpy at 15C. Extreme Dpy or L1 lethal at 25C.
CB6246 C. elegans sqt-3(e2911) V. Show Description
Slightly dumpy. Variable cold-sensitive lethal (poor viability at 15C). Unusual missense allele (D297G) of sqt-3, suppresses dpy-31 lethality. Reference: Novelli et al. (2006) PMID: 16452136.
CB6430 C. elegans sqt-3(e2924) V. Show Description
Squat, dumpy at 15C. Inviable at higher temperatures. Deletion of most of sqt-3 coding sequence. Null by antibody staining.
CB6449 C. elegans sqt-3(e2909) V. Show Description
Weak dumpy. Variable tail abnormal at 20C or higher. Cold-sensitive: most arrest as pretzel-stage embryos, with some escapers arresting as severely distorted L1 larvae at 15. Unusual missense allele (K280E) of sqt-3, cold-sensitive lethal and suppressor of dpy-31 lethality. Reference: Novelli et al. (2006) PMID: 16452136.
DH238 C. elegans sqt-3(b238) V. Show Description
Temperature sensitive roller. PKA rol-4.
CB5664 C. elegans dpy-31(e2770) III; sqt-3(e2809) V. Show Description
Dumpy (partially-suppressed Dpy-31). Sqt-3 mediated suppression of dpy-31 lethality. Reference: Novelli et al. (2004) PMID: 15579684.
CB6335 C. elegans dpy-31(e2919) III; sqt-3(e2906) V. Show Description
Homozygous viable dpy. dpy-31(e2919) homozygotes are almost inviable, but lethality is efficiently suppressed by sqt-3(e2906). Reference: Novelli J, et al., Genetics. 2004 Nov;168(3):1259-73.
RW3538 C. elegans myo-3(st386)/sqt-3(e24) V. Show Description
Heterozygotes are WT. Segregates WT, Sqt and Dead embryos (2-fold arrest). myo-3 Null. Maintain by picking WT.
JR728 C. elegans sqt-3(sc8) unc-61(e228)/wDf4 V. Show Description
Pick WT to maintain. Throws WT, Roller Uncs and dead eggs. wDf4 arrests as dead eggs with no gut. sc8 previously called rol-4(sc8).
DA709 C. elegans +/nT1 IV; sqt-3(sc63) eat-6(ad467) unc-76(e911)/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and Sqt Unc larvae that grow very slowly.
KK288 C. elegans sqt-3(sc8) par-1(b274) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, RolPar (adult homozygotes lay eggs that don't hatch) and dead eggs. nT1[unc-?(n754) let-?] is dominant Unc and recessive lethal. Strict maternal effect. sc8 previously called rol-4(sc8).
DA869 C. elegans sqt-3(sc8) lin-25(n545) him-5(e1467) unc-76(e911) V. Show Description
Roller. Unc. Vulvaless. Throws males. sc8 previously called rol-4(sc8).
ML743 C. elegans rdy-2(mc40)/sqt-3(sc63) him-5(e1467) unc-76(e911) V. Show Description
Heterozygotes are WT and segregate WT, Rol Uncs, and dead L2 larvae that are translucent and often found away from the bacterial lawn (can be difficult to spot on the lawn).
MT2663 C. elegans sqt-3(sc63) him-5(e1467) egl-1(n986) unc-76(e911) V. Show Description
Dominant Egl. Unc. Dpy (ts). Throws males.
MT5439 C. elegans sqt-3(sc8) unc-76(e911) V; lon-2(e678) xol-1(y70) X. Show Description
Roller. Long. Unc. XO Lethal. sc8 previously called rol-4(sc8).
OCF13 C. elegans lpin-1(ok2761)/sqt-3(sc8) unc-61(e228) V; ltIs37 IV; jjIs1092. Show Description
jjIs1092 [(pNUT1) npp-1::GFP + unc-119(+)]. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Heterozygotes are wildtype with GFP+ and mCherry+. lpin-1(ok2761) homozygotes die as L1 larvae. Also segregates Unc Rol.
ATD1 C. elegans unc-119(ed3) III; sqt-3(sc8) par-1(b274) V/nT1[unc-?(n754) let-?] (IV;V); zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Balanced heterozygotes are Unc and segregate Unc (heterozygotes), Rol Par (sqt-3 par-1 homozygotes; maternal effect lethal), and dead eggs (nT1 homozygotes). NMY-2::GFP is expressed in the germline and somatic gonad. Cross of JJ1473 and KK288. Unknown if unc-119(ed3) is still present or homozygous in background. Reference: Small LE & Dawes AT. Mol Biol Cell. 2017 Aug 1;28(16):2220-2231.
GS807 C. elegans unc-32(e189) lin-12(n676n930) III; sqt-3(sc8) sel-1(e1948) V. Show Description
RollerUnc. At 25C e1948 recessively suppresses the Egl phenotype of n676n930. At 15C a high percentage of hermaphrodites have a 0 AC-Egl phenotype. e1948 recessively suppresses vulval lineage defects and proximal mitosis. sc8 previously called rol-4(sc8). See also WBPaper00002448. Do not distribute this strain; other labs should request it from the CGC.
JR113 C. elegans sma-1(e30) unc-76(e911) wDf2/sqt-3(sc8) unc-61(e228) V. Show Description
Heterozygotes are WT and segregate WT, RolUncs and dead eggs. Homozygous wDf1 embryos arrest uniformly as unenclosed balls of differentiated cells. wDf2 formerly called zen-1(w1). sc8 previously called rol-4(sc8).
PHX3691 C. elegans sqt-3(syb3691[sqt-3::mNG(int)]) V. Show Description
mNeonGreen tag inserted into endogenous sqt-3 locus between CFCS and collagen domains. GCCTACGGAGGACCAGAAGTCAACC -> GCCTACGGAGGA^CCAGAAGTCAACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.