| AMH61 |
C. elegans |
unc-13(e51) I; ddi-1(ok1468) IV. Show Description
ddi-1 also known as vsm-1.
|
|
| BC110 |
C. elegans |
dpy-14(e188) unc-13(e51) let-85(s142)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate WT, Unc and DpyUncLets. Lethal at L1. Maintain by picking WT.
|
|
| BC112 |
C. elegans |
dpy-14(e188) unc-13(e51) let-82(s85)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc, and DpyUncLet (DpyUnc Larvae are abnormal). Maintain by picking WT.
|
|
| BC115 |
C. elegans |
dpy-14(e188) unc-13(e51) let-81(s88)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUncLets are abnormal larvae and die in early larval development. Pick WT to maintain.
|
|
| BC123 |
C. elegans |
dpy-14(e188) unc-13(e51) let-84(s91)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLet. The DpyUncs are abnormal larvae that die in late larval development. Pick WT to maintain.
|
|
| BC124 |
C. elegans |
dpy-14(e188) unc-13(e51) unc-37(s80)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLet. The DpyUncLet larvae are abnormal. Pick WT to maintain.
|
|
| BC125 |
C. elegans |
dpy-14(e188) unc-13(e51) let-79(s81)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethal. The DpyUncs are abnormal larvae that die in early larval development. Pick WT to maintain. Note 5/92: probably has lost dpy-14.
|
|
| BC148 |
C. elegans |
dpy-14(e188) let-75(s101) unc-13(e51)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUncs are abnormal larvae that die in early larval development (L1). Pick WT to maintain. Previously called myo-1(s101).
|
|
| BC149 |
C. elegans |
dpy-14(e188) unc-13(e51) let-83(s97)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUnc are abnormal larvae which die in early larval development. Pick WT to maintain.
|
|
| BC157 |
C. elegans |
dpy-14(e188) unc-13(e51) let-80(s96)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and Lethal DpyUncs. Lethal early larval. Pick WT to maintain.
|
|
| BC159 |
C. elegans |
dpy-5(e61) unc-13(e51) I; sDp1 (I;f). Show Description
Animals with the duplication are WT. Animals which have lost the duplication are DpyUnc. Segregates 2% males. The males are sterile. The duplication is homozygous lethal.
|
|
| BC160 |
C. elegans |
dpy-14(e188) unc-13(e51) let-87(s106)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate WT, paralyzed Unc and DpyUncLethal. Lethal early larval (L1). Maintain by picking WT.
|
|
| BC162 |
C. elegans |
dpy-14(e188) unc-13(e51) let-88(s132)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate WT, paralyzed Unc and DpyUncLethal. The DpyUncs are abnormal larvae which die in early larval development. Pick WT to maintain.
|
|
| BC165 |
C. elegans |
dpy-14(e188) unc-13(e51) let-89(s133)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate WT, paralyzed Unc and DpyUncLethal. Lethal early larval. Maintain by picking WT.
|
|
| BC184 |
C. elegans |
dpy-14(e188) unc-13(e51) bli-4(s90)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate WT, paralyzed Unc and DpyUncLethals. The DpyUncs are abnormal larvae which die in late larval development. Pick WT to maintain. s90 previously called let-77. See also WBPaper00003507. CGC received new stock 3/01.
|
|
| BC215 |
C. elegans |
dpy-14(e188) unc-13(e51) let-78(s82)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUncs are abnormal larvae which die in late larval development. Pick WT to maintain.
|
|
| BC220 |
C. elegans |
dpy-14(e188) unc-13(e51) let-90(s140)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate WT, paralyzed Unc and DpyUncLethal. The DpyUncs are abnormal larvae. Pick WT to maintain.
|
|
| BC244 |
C. elegans |
dpy-14(e188) let-86(s141) unc-13(e51)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUncs are abnormal larvae which die in early larval development. Pick WT to maintain.
|
|
| BC455 |
C. elegans |
unc-15(e73) unc-13(e51) I. Show Description
Paralysed Unc.
|
|
| BS3156 |
C. elegans |
unc-13(e51) gld-1(q485)/hT2 [dpy-18(h662)] I; +/hT2 [bli-4(e937)] III. Show Description
Heterozygotes are wild-type and segregate WT heterozygotes, Unc (unc-13 gld-1 homozygotes), and Dpy (hT2 homozygotes; the bli-4 mutation is suppressed by dpy-18). XX Uncs have tumorous germline and are sterile; XO Uncs are cross fertile (though they don't mate due to the Unc mutation). q485 is the canonical allele of gld-1. It behaves like deletions of the locus in complementation tests and thus is genetically null. Molecularly, it is a deletion of 82 bases and fails to produce gld-1 RNA and protein.
|
|
| BS585 |
C. elegans |
unc-13(e51) ozDf5 I; nDp4 (I;V)/+. Show Description
Strain gives WT hermaphrodites and dead eggs.
|
|
| CB51 |
C. elegans |
unc-13(e51) unc-122(n2916) I. Show Description
Unc. See WBPaper00003781 regarding the unc-122 mutation.
|
|
| CGC138 |
C. elegans |
unc-13(e51)/hT1 I; dpy-11(e224)/hT1 [unc-42(e270) umnIs79] V. Show Description
umnIs79 [myo-2p::GFP + NeoR, I: 6284001] I. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, arrested hT1 homozygotes (GFP+), and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
|
|
| CGC139 |
C. elegans |
unc-13(e51)/hT1 I; dpy-11(e224)/hT1 [unc-42(e270) umnIs80] V. Show Description
umnIs80 [myo-2p::mKate2 + NeoR, I: 6284001] I. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
|
|
| CGC29 |
C. elegans |
unc-13(e51)/hT1 [umnIs18] I; dpy-11(e224)/hT1 [unc-42(e270)] V. Show Description
umnIs18 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] I. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, Dpy Unc, arrested hT1 homozygotes(GFP+), and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
|
|
| CGC75 |
C. elegans |
unc-13(e51)/hT1 [umnIs58] I; dpy-11(e224)/hT1 [unc-42(e270)] V. Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.
|
|
| DR168 |
C. elegans |
unc-13(e51) daf-8(e1393) I. Show Description
Temperature sensitive dauer constitutive. Unc. Semi-paralyzed. Closely linked.
|
|
| DR435 |
C. elegans |
dpy-5(e61) unc-13(e51) I. Show Description
Dpy. Unc.
|
|
| EG9631 |
C. elegans |
unc-13(s69) I. Show Description
Aldicarb resistant. This allele is a small exonic deletion that frameshifts exon 21, thus deleting the MUN domain of both long and short isoforms of unc-13. The reference allele e51 is R471-stop, affecting only UNC-13L. Derived by 2x outcross of BC168. Reference: Rose AM & Baillie DL. Genetics. 1980 Nov;96(3):639-48.
|
|
| EM598 |
C. elegans |
hlh-2(bx115) unc-13(e51) I; him-5(e1490) V. Show Description
Paralyzed Unc. Throws males. hlh-2(bx115) has no phenotype in this background.
|
|
| EU707 |
C. elegans |
air-2(or207) unc-13(e51) I. Show Description
Temperature sensitive. Grow at permissive temperature of 15C. Fully penetrant cytokinesis defect at the restrictive temperature of 25C. Semi-dominant Unc.
|
|
| GS305 |
C. elegans |
evl-17(ar94)/dpy-5(e61) unc-13(e51) I. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC.
|
|
| GS307 |
C. elegans |
dpy-5(e61) cye-1(ar95)/unc-13(e51) I. Show Description
Heterozygotes are WT and segregate WT, Uncs and Sterile Dpys which have an everted vulva. ar95 previously called evl-10(ar95). See also WBPaper00004382. Do not distribute this strain; other labs should request it from the CGC.
|
|
| GS454 |
C. elegans |
evl-9(ar121)/dpy-5(e61) unc-13(e51) I. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Steriles which have an everted vulva. Do not distribute this strain; other labs should request it from the CGC.
|
|
| JEL1134 |
C. elegans |
polq-1(xoe51) III. Show Description
Superfically wild-type. polq-1(xoe51) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The polq-1 repair template (AGAGAATTCTCTGAAGATCCATTAATATTGCTTACCGAAGGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAGCTAGCAGAGTTTTCGCCGCAATTCTCAGACTTTGGTAATGATTTC) and guide RNA (ATTGCGGCGAAAACTCTCTT) were injected into N2 and the resulting progeny were analyzed by PCR using ATAGGCAAATGGCTGGACGG and TCAAAGCAGTCTTCTCGGCA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.
|
|
| JEL1142 |
C. elegans |
hsr-9(xoe17) I; brc-1(xoe4) polq-1(xoe51) III. Show Description
Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.
|
|
| JK1466 |
C. elegans |
gld-1(q485)/dpy-5(e61) unc-13(e51) I. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and steriles with a tumorous germline. Pick WT to maintain. Do not distribute this strain; other labs should request it from the CGC.
|
|
| JK1573 |
C. elegans |
ces-1(n703) qDf6/dpy-14(e188) unc-13(e51) I. Show Description
Heterozygotes are Ces and grow very slowly and are often sterile. They segregate very early larval lethals, sickly DpyUncs and more hets. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC.
|
|
| JK1743 |
C. elegans |
gld-2(q497)/dpy-5(e61) unc-13(e51) I. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Steriles. Do not distribute this strain; other labs should request it directly from the CGC.
|
|
| JK2208 |
C. elegans |
gld-2(dx40)/dpy-5(e61) unc-13(e51) I. Show Description
Segregates wild-type hets, Ste dx40 homozygotes, and Dpy Uncs. Maintain by picking wild-type and checking for correct segregation. Do not distribute this strain; other labs should request it directly from the CGC.
|
|
| KR1037 |
C. elegans |
unc-13(e51)/hT1 I; dpy-11(e224)/hT1 [unc-42(e270)] V. Show Description
Pick wild-type to maintain. Segregates wild-type, Dpy Unc, arrested hT1 homozygotes, and dead eggs. Reference: McKim KS, et al. Genetics. 1988 Dec;120(4):987-1001.
|
|
| KR1567 |
C. elegans |
dpy-14(e188) unc-13(e51) I; hDp73 (I;X;f?). Show Description
Dpy-14 phenotype. Segregates Dpy-14 and Dpy-14 Unc-13 progeny. Pick Dpy-14 and check for correct segregation of progeny to maintain. hDp73 probably linked to another chromosome. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
| KR1704 |
C. elegans |
dpy-14(e188) unc-13(e51) I; hDp68 (I;X;f). Show Description
Wild-type phenotype. Segregates WT and Dpy-14 Unc-13. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
| KR1705 |
C. elegans |
dpy-14(e188) unc-13(e51) I; hDp70 (I;X;f). Show Description
Wild-type phenotype. Segregates WT and Dpy-14 Unc-13. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
| KR1706 |
C. elegans |
dpy-14(e188) unc-13(e51) I; hDp66 (I;X;f). Show Description
Wild-type phenotype. Segregates WT and Dpy-14 Unc-13. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
| KR1707 |
C. elegans |
dpy-14(e188) unc-13(e51) I; hDp46 (I;X;f). Show Description
Wild-type phenotype. Segregates WT and Dpy-14 Unc-13. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
| KR1718 |
C. elegans |
dpy-14(e188) unc-13(e51) I; hDp45 (I;X;f). Show Description
Wild-type phenotype. Segregates WT and Dpy-14 Unc-13. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
| KR1722 |
C. elegans |
dpy-14(e188) unc-13(e51) I; hDp52 (I;X;f). Show Description
Wild-type phenotype. Segregates WT and Dpy-14 Unc-13. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
| KR1725 |
C. elegans |
dpy-14(e188) unc-13(e51) I; hDp44 (I;X;f). Show Description
Wild-type phenotype. Segregates WT and Dpy-14 Unc-13. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|
| KR1726 |
C. elegans |
dpy-14(e188) unc-13(e51) I; hDp50 (I;X;f). Show Description
Dpy-14 phenotype, weaker than e188. Healthy, vigorous, segregates Dpy-14 and Dpy-14 Unc-13. Maintain by picking Dpy-14 and checking for correct segregation of progeny. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
|
|