More Fields
Strain Species Genotype
BC157 C. elegans dpy-14(e188) unc-13(e51) let-80(s96)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and Lethal DpyUncs. Lethal early larval. Pick WT to maintain.
FT250 C. elegans unc-119(ed3) III; xnIs96. Show Description
xnIs96 [pJN455(hmr-1p::hmr-1::GFP::unc-54 3'UTR) + unc-119(+)]. GFP starts in membranes at~100 cell stage, becomes bright apically in older embryos and larvae; most prominent in nerve ring in adults. Reference: Achilleos et al. (2010) Development 137(11):1833-42.
GOU3103 C. elegans unc-70(cas962[GFP::unc-70]) V. Show Description
GFP inserted at the N-terminus of the endogenous unc-70 locus. Reference: Jia R, et al. (2019). Spectrin-based Membrane Skeleton Supports Ciliogenesis. PLoS Biology.
NH3119 C. elegans F54A5.3a(ok198) I. Show Description
No obvious phenotype. The primers used to isolate (ok198)were: LS969.E1: TGAGCTCGGAGATGTTGCT; LS969.E2: CCGGTCATTCCTCATTCACT; LS969.I1: GGGAGGGTCTTACGTTGTGA; LS969.I2: GTCGAAAAATCAACTTGCGG; The deletion band runs at about 2000bp. The wt band (based on the inside primers) is 3195bp making the deletion about 1200bp of the gene F54A5.3.
PS968 C. elegans unc-101(sy216)/hIn1 [unc-54(h1040)] I. Show Description
Heterozygotes are WT and segregate embryonic lethals (sy216 homozygotes) and paralyzed Uncs (h1040 homozygotes). sy216 is a deletion of the unc-101 gene region. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.