More Fields
Strain Species Genotype
BC184 C. elegans dpy-14(e188) unc-13(e51) bli-4(s90)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate WT, paralyzed Unc and DpyUncLethals. The DpyUncs are abnormal larvae which die in late larval development. Pick WT to maintain. s90 previously called let-77. See also WBPaper00003507. CGC received new stock 3/01.
HZ771 C. elegans him-5(e1490) V; bpIs90. Show Description
bpIs90 [tia-1p::tia-1::GFP + rol-6(su1006)]. Rollers. Rolling phenotype is more apparent when raised >20C. TIA-1::GFP is homogenously distributed in the cytoplasm during embryogenesis. At larval stages, diffuse TIA-1::GFP signals are observed in seam cells and hypodermal cells. TIA-1::GFP forms distinct bodies, especially in seam cells and hypodermal cells, under stress conditions. Reference: Sun YY, et al. Protein Cell. 2011 Nov;2(11):918-39.
JK3776 C. elegans qIs90. Show Description
qIs90 [ceh-22b::VENUS (pJK1082) + influenza viral DNA]. qIs90 is an integrated complex array; integration site not mapped. ceh-22b::VENUS can be easily identified by its expression in the pharynx. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
OP90 C. elegans unc-119(ed3) III; wgIs90. Show Description
wgIs90 [nhr-6::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
PS3972 C. elegans unc-119(ed4) syIs90 III. Show Description
syIs90 [egl-17::yfp + unc-119(+)] III. Expressed in vulC and vulD. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
TX903 C. elegans teIs90 I; unc-119(ed3) III; him-3(e1147) IV. Show Description
teIs90 [(pRL1483) pie-1p::GFP::taf-4 + unc119(+)]. Sick at high temperatures. Maintain at 20C, but it will silence after some generations.
BC1772 C. elegans dpy-18(e364)/eT1 III; unc-46(e177) let-334(s908)/eT1 V. Show Description
Heterozygotes are WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT.
PS9048 C. elegans msp-40(sy1604) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of msp-40; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAACACCCCGGATGGAGCTGCTAAGCAATTCCGCCG Right flanking sequence: TGAGTGGTTCCAAGGAGACGGCATGGTTCGTCGTAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTCCTTGGAACCACTCACGG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616