More Fields
Strain Species Genotype
BC215 C. elegans dpy-14(e188) unc-13(e51) let-78(s82)/unc-15(e73) I. Show Description
Heterozygotes are WT and segregate more WT, paralyzed Unc and DpyUncLethals. The DpyUncs are abnormal larvae which die in late larval development. Pick WT to maintain.
GS4249 C. elegans unc-4(e120) II; arIs82. Show Description
arIs82 [lin-12::GFP + egl-17p::lacZ + unc-4(+)]. Reference: Shaye DD, Greenwald I. Nature. 2002 Dec 12;420(6916):686-90. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
OP82 C. elegans unc-119(tm4063) III; wgIs82. Show Description
wgIs82 [ceh-16::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Niu W, et al. Genome Res. 2011 Feb;21(2):245-54. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
BC2509 C. elegans dpy-18(e364)/eT1 III; unc-60(e677) dpy-11(e224) let-408(s827)/eT1 V. Show Description
WT strain that segregates WT, Unc-36 and dead eggs. Egg lethal. Maintain by picking WT.
BC2510 C. elegans dpy-18(e364)/eT1 III; unc-60(e677) let-426(s826) dpy-11(e224)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT.
BC2648 C. elegans dpy-18(e364)/eT1 III; unc-60(e677) dpy-11(e224) let-409(s823)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal early larval. Maintain by picking WT.
BC2649 C. elegans dpy-18(e364)/eT1 III; dpy-11(e224) let-337(s825)/eT1 V. Show Description
Heterozygotes are WT and segregate WT, Unc-36, DpyUncLet and dead eggs. Lethal mid-larval. Maintain by picking WT.
GS8255 C. elegans arTi101. Show Description
arTi101 [lin-31p::ERK::KTR(S43A, T55A, S62A)::mClover::T2A::mCherry::his-11::unc-54 3'UTR + rps-27p::NeoR::unc-54 3'UTR]. Superficially wild-type. arTi101 transgene is a single-copy transposon insertion expressing a mutant, unphosphorylated form of a fluorescent protein (ERK::KTR::mClover) that reports MPK-1 kinase activity in vulval precursor cells (VPCs). A nuclear histone marker is co-expressed (mCherry::H2B). Use arTi101 as a negative control for transgene arTi85. Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.
JPS844 C. elegans vxIs824; vxIs591. Show Description
vxIs824 [rab-3p::ND18ApoE4::unc-54 3'UTR + myo-2p::mCherry::unc-54 3'UTR]. vxIs591 [tph-1p::GFP::unc-54 3'UTR]. Integrated transgene driving expression of human APOE4 throughout the nervous system; induces age-related neurodegeneration of HSNs and bag-of-worms in up to 60% of D3 adult worms. GFP expression in all serotonergic neurons. Reference: Sae-Lee et al. G3 (Bethesda) 2020 Aug 5;10(8):2851-2861. PMID: 32580938
JPS845 C. elegans vxIs823 II; vxIs824; vxIs591. Show Description
vxIs823 [rab-3p::APP::mCherry::unc-54 3'UTR] II. vxIs824 [rab-3p::ND18ApoE4::unc-54 3'UTR + myo-2p::mCherry::unc-54 3'UTR]. vxIs591 [tph-1p::GFP::unc-54 3'UTR]. Integrated transgenes driving expression of human APOE4 and human APP throughout the nervous system; induces age-related neurodegeneration of HSNs and bag-of-worms in >60% of D3 adult worms. GFP expression in all serotonergic neurons. Reference: Sae-Lee et al. G3 (Bethesda) 2020 Aug 5;10(8):2851-2861. PMID: 32580938
OH12930 C. elegans pha-1(e2123) III; evIs82b IV; otEx5966. Show Description
evIs82b [unc-129::GFP + dpy-20(+)] IV. otEx5966 [bnc-1p::mChOpti + pha-1(+)]. Maintain at 25C to select for presence of otEx5966 array. VA/VB motor neuron class-specific red fluorescent reporter. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH14044 C. elegans evIs82b IV; bnc-1(ot763) V. Show Description
evIs82b [unc-129::GFP + dpy-20(+)] IV. De-repression of ectopic effector genes in VA/VB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH14045 C. elegans evIs82b IV; bnc-1(ot721) V. Show Description
evIs82b [unc-129::GFP + dpy-20(+)] IV. De-repression of ectopic effector genes in VA/VB class motor neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH17019 C. elegans otIs825. Show Description
otIs825 [degl-1p::GFP + unc-122p::GFP]. Reference: Cros C & Hobert O. bioRxiv 2022.04.19.488792; doi: https://doi.org/10.1101/2022.04.19.488792.
OH4125 C. elegans evIs82b IV; wrk-1(ok695) X. Show Description
evIs82b [unc-129::GFP + dpy-20(+)] IV.
OH4128 C. elegans juIs76 II; evIs82b IV. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. evIs82b [unc-129::GFP + dpy-20(+)] IV.
PS8201 C. elegans oac-2(sy1218) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aattgtggaatttttagATTTCGAAGAATCCTCCC Right flanking sequence: GCTGTACTACTTGACCATCTTCCTCATAGTAGTCATG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGTGGCATTACGAAGGAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8203 C. elegans affl-2(sy975) Y55B1BR.1(sy1220) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55B1BR.1 into sup-45 mutant (sy975); Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGTACCCGTAGAATGCTTGAAGAAATGGCCGGCC Right flanking sequence: TCGTGGGAACTAAACCATTGAGCCAGCTTCCTCGAAG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGAAGAAATGGCCGGCCTCG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616. affl-2 formerly known as sup-45.
PS8205 C. elegans Y62F5A.10(sy1222) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y62F5A.10; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAAGAAGAAGATAACACGGAAGGAGAAATCCAACA Right flanking sequence: CCGCACTGAACAAAACAGCATCCAACGACGATCTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGTTTTGTTCAGTGCGGTGT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8207 C. elegans F44E5.3(sy1224) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of F44E5.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTAGAAAGACTATATGCCATAGTAGAAGATCCGCTC. Right flanking sequence: AGTGAGTTCGTTGCAGGCGGACTACGTTgtaagtttg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CCTGCAACGAACTCACTGAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8219 C. elegans Y69A2AR.19(sy1226) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y69A2AR.19; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cagAAAAAATCAACGACAATCACCTGGACAGCCCCC Right flanking sequence: GCTCGGATGGACACGAACTAATGGAAAACCCCTTG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TCACCTGGACAGCCCCCGCT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8221 C. elegans pals-26(sy1228) III. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-26. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATTGCTCAAGACATGCGAAATAACATGCAACCTGAA right flanking sequence: CGTGAGCGCCGGCAAAGGGAGCTTGAAGCTTTAG Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTTGCCGGCGCTCACGTTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8223 C. elegans Y39C12A.9(sy1230) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y39C12A.9; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCATATATGAATTCAATGGCAAAAGTAGACCCGAA Right flanking sequence: TGATCCATACGTGTTTAAAAAGGATTTAGgtacgtg inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAAACACGTATGGATCATTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8225 C. elegans F52G2.3(sy1232) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of F52G2.3; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTCAAATTGACGGTGTCTGCTTCATAAGTCCTGAG Right flanking sequence: TGCGGAACCATAGTTATCGAACCGCCGGCTCCGG inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATAACTATGGTTCCGCACTC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8234 C. elegans srw-54(sy1234) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srw-54; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: TTTGGTACGATCTGCAAAACATCATCAGGCCTATT Right flanking sequence: GATGTGTACTTGGATTACTTCAACTTTTCAATATC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TAATCCAAGTACACATCAAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8240 C. elegans srw-43(sy1240) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srw-43; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cactttccaatatttcagCATACCTCCCCTGTCCT Right flanking sequence: ATCTGGAAATGTATTTTATCCAATTATTCAATTCC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CATACCTCCCCTGTCCTATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8250 C. elegans oac-24(sy1246) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-24; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: aaaaaatttcagATTCTTTGTCATTTCCGGATACC Right flanking sequence: TCATGGCGAAAAATTTAACGAAGACTAAACTTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TGTCATTTCCGGATACCTCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8252 C. elegans srw-36(sy1248) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srw-36; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATTGACTGTTAACCAATTTCTGATAGGTATCGTAGT Right flanking sequence: TTGTGGGATTATCCACAATGTATGTAGTATCATC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGATAGGTATCGTAGTTTG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8263 C. elegans srz-103(sy1254) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of srz-103; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGATTAATTGTAGCGTATATTCTCATATGTCGTA Right flanking sequence: ATCTGGATGTTCTTCAAAGATTGCCAATTGTATTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : TATTCTCATATGTCGTAATC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8265 C. elegans oac-38(sy1256) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-38; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTTTAGGATTTCACTTCCTGCCAGATGTATTTCC Right flanking sequence: TAATGGATACTTAGGAGTTGATCAgtaagttttcaac inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGCCAGATGTATTTCCTAA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
PS8278 C. elegans syIs536. Show Description
syIs536 [15xUAS::lin-3c::SL2::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] cGAL effector for epidermal growth factor
PS8279 C. elegans syIs537; syIs300 Show Description
syIs537 [glr-3p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for RIA neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
PS8282 C. elegans syIs554; syIs300 Show Description
syIs554 [nmr-1p::NLS::cGAL(DBD)::gp41-1-N-intein::let-858 3'UTR + flp-20p::NLS::gp41-1-C-intein::cGAL(AD)::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. Split cGAL driver for PVC neuron. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
PS8284 C. elegans syIs556. Show Description
syIs556 [15xUAS::GtACR::SL2::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] Natural light-gated anion channel cGAL effector, inhibited with blue light.
PS8288 C. elegans syIs559; syIs300 Show Description
syIs559 [flp-1p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for AVK neurons. syIs300 [15xUAS::(delta)pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)] is a GFP cGAL effector.
PS8290 C. elegans syIs561. Show Description
syIs561 [ttx-3p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)] cGAL driver for AIY neurons.
PS8293 C. elegans syIs564. Show Description
syIs564 [odr-10p::NLS::GAL4(sk)::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder (NEB)]. cGAL driver for AWA neurons.