Search Strains

More Fields
Strain Species Genotype Add
BA15 C. elegans rrf-3(hc15) II. Show Description
Temperature sensitive. Maintain at 15C.
BC14416 C. elegans dpy-5(e907) I; sEx14416. Show Description
sEx14416 [rCes Y71G12B.15::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BE15 C. elegans rol-8(sc15) II. Show Description
Left roller as adult.
BN740 C. elegans npp-24(bq15[gfp(FRT)::npp-24]) bqSi189 II. Show Description
bqSi189 [lmn-1p::mCherry::his-58 + unc-119(+)] II. Cassette for GFP-labeling and FLP-mediated inactivation of endogenous mel-28 inserted by CRISPR/Cas9 after the npp-248 start codon. FRT sites in GFP introns 1 & 2 enable FLP-mediated conditional knockout; in the absence of FLP, the construct behaves as normal GFP. bqSi189 is a single-copy MosSCI insertion into ttTi5605. Reference: Thomas L, et al. bioRxiv 2022.08.22.504855; doi: https://doi.org/10.1101/2022.08.22.504855
CB315 C. elegans unc-34(e315) V. Show Description
Unc. Male spicules abnormal. Recessive. M-MATING-NO SUCCESS.
CHS1230 C. elegans srb-6(yum2387) srb-7(yum2388) srb-8(yum2389) srb-11(yum2390) srb-15(yum2391) srb-16(yum2392) srb-17(yum2393) srb-18(yum2394) srb-19(yum2395) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CZ24990 C. elegans unc-44(ju1412[unc-44::GFP]) IV. Show Description
Endogenous unc-44 locus tagged for UNC-44L::GFP expression. The long isoform of UNC-44 is specific to neuronal expression. Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.
CZ25013 C. elegans unc-44(ju1413[unc-44::gfp::LoxP::3xflag]) IV. Show Description
unc-44(ju1413[unc-44::GFP::LoxP::3xflag]) IV. UNC-44C (short isoform of UNC-44) tagged with GFP. UNC-44C is strongly expressed in multiple tissues: nervous system (from 1.5-fold stage to adult), epidermis (from early embryo to adult), seam cells (from L1 to L4), vulva (from L3 to adult), and spermatheca/sheath cells (from L4 to adult). Reference: Chen F, Chisholm AD, Jin Y. Development. 2017 Feb 15;144(4):698-707.
GG15 C. elegans emb-15(g15) X. Show Description
Temperature sensitive. Maintain at 15C. Will also grow at 20C, but not 25C.
HR1184 C. elegans +/szT1 [lon-2(e678)] I; nmy-1(sb115) dpy-8(e130)/szT1 X. Show Description
Heterozygotes are WT and segregate WT, Dpy Uncish with occasional Rol (nmy-1 dpy-8), Lon males, and dead eggs. nmy-1 homozygotes have a low brood size and are slow growing. sb115 is a null, truncation allele.
MSB115 C elegans unc-70(mir6[loxP] mir16[loxP]) V. Show Description
Superficially wild-type. LoxP sites were inserted into near the 5' and 3' ends of the endogenous unc-70 locus to facilitate conditional or cell-specific knockout of the gene. The 5' loxP site can be detected by PCR using the primers 5' tttattaatctatgatttttcagcaaaa 3' and 5' tgacgataatctcttaaaattttgc 3'. The 3' loxP site can be detected by PCR using the primers 5' acgtactgtcgctgaggttacc 3' and 5' gacgtcgatacaaataattcgtccca 3'. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987
NB515 C. elegans polq-1(tm2572) III; parg-2(ok980) IV. Show Description
Hypersensitivity to ionizing radiation due to the parg-2(ok980) mutation is rescued by the polq-1(tm2572) mutation.  The double mutant is as sensitive as the wild-type to ionizing radiation. Parental parg-2(ok980) strain outcrossed 6 times; parental polq-1(tm2572) strain outcrossed 5 times. Reference: Bae W, et al. Hypersensitivity to DNA double-strand breaks associated with PARG deficiency is suppressed by exo-1 and polq-1 mutations in Caenorhabditis elegans. The FEBS Journal, In press.
OP730 C. elegans unc-119(tm4063) III; wgIs730. Show Description
wgIs730 [vab-15::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
OS11484 C. elegans nsIs700 V Show Description
nsIs700 [nep-2(prom7)::tagRFP]. RFP expression specifically in GLR glia. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
OS11703 C. elegans nsIs746 V. Show Description
nsIs746 [nep-2(prom7)::GFP]. GFP expression specifically in GLR glia. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
OS11715 C. elegans nsIs758 V. Show Description
nsIs758 [nep-2(prom7)::2xNLS::YFP]. Nuclear YFP expression specifically in GLR glia. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
OS12700 C. elegans unc-30(ns959[unc-30::GFP::degron]) IV. Show Description
Linker with GFP tag and degron inserted at the C terminus of the endogenous unc-30 locus. GFP expression in ASG, AVJ, DD, VD, and PVP neurons and GLR glia. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
OS13288 C. elegans let-381(ns995[let-381::gfp::degron]) I. Show Description
Linker with GFP tag and degron inserted at the C terminus of the endogenous let-381 locus. GFP expression in GLR glia, HMC and coelomocytes. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
PHX4689 C. elegans nep-2(syb4689[gfp::h2b::sl2::nep-2]) II. Show Description
SL2::GFP::H2B tags inserted at N-terminus of nep-2 endogenous locus. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
PHX5704 C. elegans gbb-1(syb5704[gbb-1::sl2::gfp::h2b]) X. Show Description
SL2::GFP::H2B tags inserted at C-terminus of gbb-1 endogenous locus. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
PHX5759 C. elegans gbb-2(syb5759[gbb-2::sl2::gfp::h2b]) IV. Show Description
SL2::GFP::H2B tags inserted at C-terminus of gbb-2 endogenous locus. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
PHX5792 C. elegans pll-1(syb5792[pll-1::sl2::gfp::h2b]) III. Show Description
SL2::GFP::H2B tags inserted at C-terminus of pll-1 endogenous locus. Reference: Stefanakis N, et al. 2024 Feb 15. doi: 10.1038/s44318-024-00049-w. PMID: 38360995.
RB515 C. elegans tag-10(ok246) II. Show Description
C31C9.1. Homozygous. Outer Left Sequence: AATGTGCTAATCCGCAAACC. Outer Right Sequence: TAATCATTTTCCAGCCCTCG. Inner Left Sequence: CCTGGGATATTTTCGCAGAC. Inner Right Sequence: CGATCATCCACTCGTCATTG. Inner primer WT PCR product: 2333. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB815 C. elegans F18F11.3(ok628) IV. Show Description
F18F11.3 Homozygous. Outer Left Sequence: CTCACTCGGGAAAGCGTTAG. Outer Right Sequence: AAAGATTGGAGATGATGGCG. Inner Left Sequence: TTGCCACCGTTGAAACATAA. Inner Right Sequence: CACCAACCACTCCCCTTCTA. Inner Primer PCR Length: 3145. Estimated Deletion Size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB915 C. elegans ksr-1(ok786) X. Show Description
F13B9.5. Homozygous. Outer Left Sequence: AGGGAAAAGATCCGGAGAAG. Outer Right Sequence: TTGACACTTGCGAGAATTGC. Inner Left Sequence: TCACGTGCGGGATACAGTAA. Inner Right Sequence: TTAAACTTCGGACTTGGCGT. Inner Primer WT PCR Product: 3347. Deletion size: 2088 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
SV1067 C. elegans unc-119(ed3) III; heSi45 IV. Show Description
heSi45 [mcm-4::mCherry + unc-119(+)] IV. This strain contains an S-phase marker that will express mCherry in all cells that undergo cell division, providing a useful alternative to BrdU and EdU staining that is suitable for live imaging. References: Korzelius J, et al. Dev Biol. 2011 Feb 15;350(2):358-69. Korzelius J, et al. PLoS Genet. 2011 Nov;7(11):e1002362.
TU2362 C. elegans vab-15(u781) X. Show Description
Variably abnormal. Severe developmental defects. Partially lethal (approx. 2/3 fail to survive). Adult hermaphrodites have variably enlarged and shortened tails and the body cuticle is twisted. Severe egg-laying defect; some animals have a protruding vulva. Tab. Unc. Lack AVM, PVM, and PLM. ALM often fail to migrate or migrate a shorter distance.
VC4204 C. elegans glb-15(gk5289[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 775 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGAGTTTTATTTACGCCATAAAAACCTGCC ; Right flanking sequence: ATGGATGGGCGTTGAAGACGTCTGACAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4843 C. elegans Y113G7B.15(gk5911[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 6750 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Please refer to supporting documents linked to the strain name in the CGC Strain Information display. Left flanking sequence: ATGATGAAAAACAAGCATTCGAAAGTGCCA. Right flanking sequence: TGAACAATGTTATGAGCAGAAAAACTTTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VT3042 C. elegans nDf50 II; her-1(n695) V; nEx1187. Show Description
nEx1187 [mir-35 mir-45(genomic) + sur-5::GFP]. Pick GFP+ to maintain. Segregates GFP+ Egl animals carrying nEx1187 (mir-35 rescuing array) and GFP- animals that develop as XX pseudomales. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.
VT3077 C. elegans nDf50/mIn1 [mIs14 dpy-10(e128)] II; sup-26(n1091) III; her-1(n695) V. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are WT with GFP+ pharynx, and segregate Dpy GFP+ mIn1 homozygotes, and GFP- low viability non-Egl hermaphrodites. Viability of first generation nDf50 homozygotes (GFP-) segregated from balanced heterozygotes is rescued by maternal contribution of mir-35-41 from balancer. Second generation GFP- animals are low viability. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.
VT3121 C. elegans sup-26(ma265 [sup-26::3xFLAG]) III. Show Description
Endogenous sup-26 locus tagged with 3xFLAG. Reference: McJunkin K & Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437. PMID: 28279983
VT3363 C. elegans nDf50/mIn1 [mIs14 dpy-10(e128)] II; nhl-2(ok818) III; her-1(n695) V. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are WT with GFP+ pharynx, and segregate Dpy GFP+ mIn1 homozygotes, and GFP- low viability non-Egl hermaphrodites. Viability of first generation nDf50 homozygotes (GFP-) segregated from balanced heterozygotes is rescued by maternal contribution of mir-35-41 from balancer. Second generation GFP- animals are low viability. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.
VT3554 C. elegans nhl-2(ma371[gfp::3xFLAG::nhl-2]) III. Show Description
Endogenous nhl-2 locus tagged at the N-terminus with GFP and 3xFLAG. Reference: McJunkin K & Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437. PMID: 28279983
XIL99 C. elegans vab-15(thu9[vab-15::GFP]) X. Show Description
GFP was inserted at the 3' end of the endogenous vab-15 coding sequence via CRISPR/Cas9. Reference: Li Y, et al. Nat Commun. 2024 Jan 9;15(1):358. doi: 10.1038/s41467-023-42677-6. PMID: 38195740.