Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
HR1184 C. elegans +/szT1 [lon-2(e678)] I; nmy-1(sb115) dpy-8(e130)/szT1 X. Show Description
Heterozygotes are WT and segregate WT, Dpy Uncish with occasional Rol (nmy-1 dpy-8), Lon males, and dead eggs. nmy-1 homozygotes have a low brood size and are slow growing. sb115 is a null, truncation allele.
MSB115 C elegans unc-70(mir6[loxP] mir16[loxP]) V. Show Description
Superficially wild-type. LoxP sites were inserted into near the 5' and 3' ends of the endogenous unc-70 locus to facilitate conditional or cell-specific knockout of the gene. The 5' loxP site can be detected by PCR using the primers 5' tttattaatctatgatttttcagcaaaa 3' and 5' tgacgataatctcttaaaattttgc 3'. The 3' loxP site can be detected by PCR using the primers 5' acgtactgtcgctgaggttacc 3' and 5' gacgtcgatacaaataattcgtccca 3'. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987