Search Strains

This strain is homozygous for a deletion (gk822) in ZK634.8, detectable by PCR using the following primers. External left primer: GCATCATTCTTTCAGTCGCA. External right primer: TGAGCTCGACGATGAATCAC. Internal left primer: CCACGTTTCGTCATTCCTCT. Internal right primer: GAGGATTCACCACCTCCTGA. Internal WT amplicon: 1922 bp. Deletion size: 1185 bp. Deletion left flank: GCTGCGGAGGTGGCGGAGGATGTGCTCCAC. Deletion right flank: AAACATATCAACGAAGATTACATTATTCAG. Validation: gk822 passed by CGH. Other deletion (gk3129) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C30F8.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2332 homozygotes (probable embryonic arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CCAGATCCAGGAAGGAATGA. External right primer: CGAAAATAATTGCAGCCCAT. Internal left primer: TTGCGAAGCCGATTTAGTTT. Internal right primer: TTCTTTCGCCTCCTTTTTCA. Internal WT amplicon: 2112 bp. Deletion size: 831 bp. Deletion left flank: TTTCGAAAAACCAGGCCGTAAACTGACAGC. Deletion right flank: TTTTTTTTCAAATTAAATTATTATACAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18C5.2. Homozygous lethal deletion chromosome linked to dpy-10 mutation, balanced by GFP- and dpy-10-marked inversion. Heterozygotes are Dpy with relatively dim GFP expression in pharynx, and segregates Dpy dim GFP, Dpy bright GFP (mIn1 homozygotes) and gk116 homozygotes (embryonic/early larval arrest). Nature of dpy-10 lesion unknown; recessive lethality could be the result of this mutation. Pick Dpy dim GFP+ and check for correct segregation of progeny to maintain." Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y48G1A.6. External left primer: GCCGACAGGATGCATAAAAT. External right primer: CCCTGCTGGTTTCATATGCT. Internal left primer: GGATTCATCGTCCGATTCTG. Internal right primer: GCCAACAGAGGAGATTCTGG. Internal WT amplicon: 1178 bp. Deletion size: 722 bp. Deletion left flank: AATCCATTAATCATTGCAAATCCGACTGGA. Deletion right flank: TTTTTTCACATTCTCCACCAGAAAAAACAT. Insertion Sequence: TTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3042) in ZK265, detectable by PCR using the following primers. External left primer: ATTTTGGCGCATATCTCACC. External right primer: AGGGTGCGATTAACGTTTTG. Internal left primer: GCGTTGGTAGGTTGTGTTGA. Internal right primer: GCACTCTGCGGGATTTCTAC. Internal WT amplicon: 2020 bp. Deletion size: 1123 bp. Deletion left flank: AAGAAGAACTGTGTGATGGGAAGCAGCAAA. Deletion right flank: AGACACTTGTGGATTCCTCGAGAAAAAGTG. Validation: No CGH probes for gk3042. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C27A2.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2162 homozygotes (sterile, lays eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAACCAGACCCACTGCTGAG. External right primer: GAAGCTTTGCTCCGTACGAC. Internal left primer: TTCCGTGAGGAAATGGAGAC. Internal right primer: AATTGACCTGACCTTGGCTG. Internal WT amplicon: 2756 bp. Deletion size: 1104 bp. Deletion left flank: TTGTAAGCATGCGCCTTTTTAACATAAGTC. Deletion right flank: AGTCTTTCTCTGCGTCTCCTCTTCTTGTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T02G5.13. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2514 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGATTGGTGCACTGGTCATT. External right primer: AATCACGATACCTTGGACGC. Internal left primer: TCGTTTCGAAATTCGTCCTC. Internal right primer: ATGCCTGGTGACGACTACCT. Internal WT amplicon: 2798 bp. Deletion size: 1179 bp. Deletion left flank: TTTAAGAACAAAAACGTACCAAATGTGCTA. Deletion right flank: ATAGAAATAAGAGATATCAAGTGTTGAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11H8.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2300 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCAGCATTTCCTGTAGCACG. External right primer: CAAGATAATCAGGCGAAGGG. Internal left primer: CGGCTTCCTTTCTTGTTGAG. Internal right primer: CGGAATGCAAGCAGGATATT. Internal WT amplicon: 3243 bp. Deletion size: 826 bp. Deletion left flank: TTCAAAAATGTTCGGAATCCTTCAGATGCT. Deletion right flank: GCGGGGGTCCTCCGGTGATTGGAGGAAGAC. Insertion Sequence: TCGGAATCCTTCAGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK993.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1015 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GAATGGAGAGACGGGTGTGT. External right primer: TTGAAAATTGTGAAGCTGCG. Internal left primer: GGCGCCAGAGTTTGATCTAC. Internal right primer: AGGTTGATGTGGACGGAGAG. Internal WT amplicon: 1907 bp. Deletion size: 1113 bp. Deletion left flank: CAAAATCTTGGTAGTCTAGAAAACCCCAAT. Deletion right flank: CATGGTGTCCTAGGAATATTTTTAAAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F23B2.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2505 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGTGTCCCGTTTTGGATGT. External right primer: AGCGTCCGAATCTGAAGAAA. Internal left primer: CGGTACTTGCAAAGAAGGCT. Internal right primer: CTGCAGATCGTTTTCCGAAT. Internal WT amplicon: 1194 bp. Deletion size: 475 bp. Deletion left flank: GTATACTATTCATTTAAAAAATATTGCCTA. Deletion right flank: TTTCTGATAAAAAAGAGCACAACTTGGTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK112.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2555 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCGCCAATATGGGACTCTC. External right primer: GGATGATACGGCTTTGTGCT. Internal left primer: AGCCATTCCTGTTCCAAATG. Internal right primer: GATTGGACTTCCTCCGTGAA. Internal WT amplicon: 3295 bp. Deletion size: 1644 bp. Deletion left flank: AACAAATGCTCAAAATGGAGCAATTGATTG. Deletion right flank: TTCTCTCGTAGATTGATGTCCTTCGCGTCG. Insertion Sequence: AATTCTCAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06G3.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2519 homozygotes (sterile, lays eggs that don't hatch). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTAAACTAGCGATGCCCG. External right primer: GAATTCCGTCCGAACCTTTT. Internal left primer: TCTTCAATCATTCACCGCTTT. Internal right primer: CGTCAACCTCTTGGCGTAGT. Internal WT amplicon: 1183 bp. Deletion size: 556 bp. Deletion left flank: TATGAGCTCCATCATATCTTTGATAGCTCT. Deletion right flank: GTCAAGGAAAGGTCATCTATCCTGAACCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R151.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk1047 homozygotes (sterile, does not lay eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGCGTGGTCTTCTTCTTCTG. External right primer: AGTTCTTCTCGACGACGCAT. Internal left primer: GAGATGCATGTCGTGTCGAT. Internal right primer: ATTGTTTCAGCACGGGAAAG. Internal WT amplicon: 2188 bp. Deletion size: 1135 bp. Deletion left flank: GGTTCTTCTCGGAATTATTGTAGTTTTTGG. Deletion right flank: GTAGAATCTCCTGCCAATGACCATTTTTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F26H9.8. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2510 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAAACATCCCATCCCGAATA. External right primer: CCATTTCACGAATTTCGGTC. Internal left primer: GTGACCCTTCGAAAAGTGGA. Internal right primer: TTTCAGTTTTTGGCACGTTTT. Internal WT amplicon: 1143 bp. Deletion size: 783 bp. Deletion left flank: CAAGTGGAGGTCATCCTCGATTTTGGCCGA. Deletion right flank: CAAAATTCTAAAAAATCGGCACTTGGAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1197) in Y47D3B, detectable by PCR using the following primers. External left primer: AAACGCGAAAATGTCGAAAC. External right primer: GATGTCTTCTCCCCCTCCTC. Internal left primer: GCGTCAAATATGTCGCGTAA. Internal right primer: TTAGTAGGCGGCTTTGTGGT. Internal WT amplicon: 1949 bp. Deletion size: 233 bp. Deletion left flank: ACCCCTGGACGTTTGGGCGCGTTTTTGTCA. Deletion right flank: TTTTCAGATAGTACACACACACATAGGAAA. Validation: No CGH probes for gk1197. Other deletions (gkDf42, gkDf43) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk3109) in C24A1.1, detectable by PCR using the following primers. External left primer: AGACCACGCCTACTACTTGGC. External right primer: CCATGTTGCTTCCAGTGCCAC. Internal left primer: CGATGTTCCGCTCTGAGCTTC. Internal right primer: TGGTCACAGTGCATTGCTCTC. Internal WT amplicon: 2029 bp. Deletion size: 1180 bp. Deletion left flank: TTTCGAAAGCTTGCCGCAAAACTCTGCCAT. Deletion right flank: AGACCTAAAAATTCCGGCAAATACCACATT. Validation: gk3109 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F02E8.2. External left primer: GACGGTGCTCATTCTTCCAT. External right primer: GAGTGGTGGATTGGGAAAGA. Internal left primer: CCAGTCCATTGCTCAATTCC. Internal right primer: CAAGCGGGTCGTTTATTTGT. Internal WT amplicon: 2195 bp. Deletion size: 1115 bp. Deletion left flank: ACTTTTATTGTGAGTTGTGCATTGCAGTTT. Deletion right flank: ACATTTTCTTTGTATTACAGTAAATTTAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T24B1.1. External left primer: ACCGAACTTGACGAATCCAC. External right primer: TGAACAGGACGATCACTGGA. Internal left primer: TAAAGTGTCCGATATTGCCG. Internal right primer: TCCGATTCCTTGCTGAATTG. Internal WT amplicon: 1116 bp. Deletion size: 494 bp. Deletion left flank: GTTATCACTGAAGATTTCGGCAGACCGGCT. Deletion right flank: GAAAACCAAAAAGTATCAAGTCATGAAATG. Insertion Sequence: AAAGACCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y11D7A.13. External left primer: GTCGCTCCCAATTTTAACCA. External right primer: AGTGTGGACTACCTGTGGGG. Internal left primer: GCTTCGGAGACGACTGAATC. Internal right primer: AGAGGAGGAAGATTGGCGAT. Internal WT amplicon: 2128 bp. Deletion size: 1200 bp. Deletion left flank: GGAGACGACTGAATCTTCGTATTGAATCTT. Deletion right flank: TAACTTTTCAGCCTCAACAAACCAAGAACC. Validation: gk1049 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R11A8.4. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52E4.7. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation, and homozygous for unlinked pharyngeal GFP insertion mIs12 (artifact of strain construction). Balanced lethal heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2238 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain.External left primer: CAATCTTCGAGCCTGGGTAA. External right primer: TACCTTCCAGTCCAGATGCC. Internal left primer: TGAAATGGCGATTTTGATGA. Internal right primer: CATGATATGGCGATGCAAAG. Internal WT amplicon: 2918 bp. Deletion size: 1120 bp. Deletion left flank: TTTCTCCATACTACGTCCTCCGAGACTTGA. Deletion right flank: AATGAAACGATTTCCTCGTTGAGACGTTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y116A8C.36. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537

This strain is homozygous for a deletion (gk1062) in Y17G7B.22, detectable by PCR using the following primers. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1412 bp. Deletion left flank: AAATAGACTATTTCGGAAAATGGAAATGAG. Deletion right flank: AAAATTATTGATTTTGACCCCAAAAATTTA. Insertion Sequence: TTGT. Validation: gk1062 passed by diagnostic PCR and CGH. Other deletions (gk3331, gkDf45) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06B8.7. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2521 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Note that ok2521 was subsequently isolated as a viable homozygote (VC2085), so the lethality in this strain is not a consequence of the deletion. External left primer: TCACAGAGCGATGGTACTCG. External right primer: CCACCTCGAACCGTTTTCTA. Internal left primer: TGCAGATTCAAACCCATCAA. Internal right primer: TCCAACATTCCTTGCGTGTA. Internal WT amplicon: 1163 bp. Deletion size: 540 bp. Deletion left flank: AGCCAACGGCATGCTGGTTATGCTCACCTT. Deletion right flank: TGTGACTTAAGACTTTCTGGCAATGATTCT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F16D3.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2634 homozygotes (mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCGGGAGATTCAAATAAGG. External right primer: TTTTGCAGCAATGGATGAAG. Internal left primer: CAAAACGCGTCTCCATTTTT. Internal right primer: ATGCACCAGTCGATGAGTCG. Internal WT amplicon: 1161 bp. Deletion size: 464 bp. Deletion left flank: CCGTCAAAACTCTCCGATCAACGTGTTTGA. Deletion right flank: CGTACAATACACAAATCAGAAAGATATTTC. Insertion Sequence: CAAATACACAAATCAGAAAGATATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

R07E5.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2653 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTTTTTGGGCCATTTTGAG. External right primer: CCATTTTCACAGCGGCTAAT. Internal left primer: AATTAATTTTTCCAGGCGGC. Internal right primer: CACAAATTTCGAAGCCATCA. Internal WT amplicon: 1186 bp. Deletion size: 399 bp. Deletion left flank: ATTTGCTAAAGTTTGAGTTTACGGGTTTTT. Deletion right flank: CTGTCTGGGAGTGGGAGTGGGAAAAGAAAG. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1058) in K12H6.12, detectable by PCR using the following primers. External left primer: CTGCGTCTCTCACTTTTCCC. External right primer: CTTCGTTGCAGACACTTGGA. Internal left primer: GGAGGAGAACAATGGCTCAA. Internal right primer: AGCTGAGTAACGGCGATTTG. Internal WT amplicon: 2398 bp. Deletion size: 1627 bp. Note: Internal right primer binding site deleted in gk1058. Deletion product from nested PCR runs at about 1150 bp. Deletion left flank: AATTATAATCATGTGGCGAAGCACATGAAA. Deletion right flank: AAATCAATATTTTCCATTGTTCTTGATGCT. Insertion Sequence: CTTTGAAAATATTTGAATTTAGCGGGAAATTCAAAATTTTTTGAGAAAAAGCTTTGGCG GGATTTTCAAAATCTTTGAAAAAAAAACACATTTCGGCGGGAATTTCAAATTTCCTGAC AAAGCTCTTCGGCGGTAAAATACCATTTTTTTCAGAAAATTTTCGATTAAAGAATTAGG ATTAAATTTTTTAAGAAAAAAAAGCAGT. Validation: PCR, CGH diagnostics for gk1058 equivocal. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C39B10.1. External left primer: TGTGGACAACCAGGAGCATA. External right primer: GTGTTTCCGGGATTCACAAC. Internal left primer: TGAAGCATCAGTGAGGTAGAATG. Internal right primer: TCTTGTCCTGATCCTTCTAGGC. Internal WT amplicon: 1190 bp. Deletion size: 628 bp. Deletion left flank: AAATTTGTAAGATGCAACTCTCAGATTAAC. Deletion right flank: GTGACACTGTATATCAACGACGGAATGCAG. Insertion Sequence: TGGTCCATAGATTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y65B4BL.5. External left primer: TATTCGGCTTTGAGGAGAGC. External right primer: AAAGGCCACTGGTGAGTTTG. Internal left primer: TGAACAAATGATTGAGCGACA. Internal right primer: ACCGATGAGCTCAAAACGAC. Internal WT amplicon: 1131 bp. Deletion size: 603 bp. Deletion left flank: GGATCACCATTCCGACGTGTCCGGCTAGCG. Deletion right flank: TGAGTGAGCATCACACCTTTCGGTGTTCCA. [NOTE: ok2861 has been found to be same molecular lesion as ok2815. These alleles are likely two isolates of the same deletion pulled from the screening pool.] Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09E10.6. External left primer: GCCACCTGCCGAGTTATTTA. External right primer: CAATTTCCTGCCATTCCTGT. Internal left primer: CGCCATGAGGTGTTTACTGA. Internal right primer: GCTACTCCCCCACCAAAAGT. Internal WT amplicon: 1115 bp. Deletion size: 398 bp. Deletion left flank: GAGGTTATTGAAAAAAAAATAAAGCAACAA. Deletion right flank: GCTTGGTGTTAACACCACATAGTGCGAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F09E10.6. External left primer: GCCACCTGCCGAGTTATTTA. External right primer: CAATTTCCTGCCATTCCTGT. Internal left primer: CGCCATGAGGTGTTTACTGA. Internal right primer: GCTACTCCCCCACCAAAAGT. Internal WT amplicon: 1115 bp. Deletion size: 635 bp. Deletion left flank: GCAGAACCCGATAGATGTCGGGCCATAGTA. Deletion right flank: AGTTTTCAGGGCCTGTTGCCTGCCTACTTC. Insertion Sequence: ACAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y116A8C.19. External left primer: GAAAAGCTCAATTTTTGCCG. External right primer: TCGCCTTCTTTTTACAGCGT. Internal left primer: CGACGTGCTATCGAACTTGA. Internal right primer: CTCCGGAATCTAGCAACCAA. Internal WT amplicon: 957 bp. Deletion size: 210 bp. Deletion left flank: CAAAGAACTGTTTTATAGTTACGATGAGTT. Deletion right flank: GAAAACTGATCTCCGTCATAAGATCCTGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y17G7B.22. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1795 bp. Deletion left flank: AAAGACGAAATTGAGAAGAAAATTGCTGAG. Deletion right flank: TTTTGGTGCTTCAAAAAACATCAAAAAATA. Insertion Sequence: AAAATTTGATACTTTTTGATGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y53C10A.15. External left primer: ATACAATGCGCCATGTTTGA. External right primer: CGGTGTGAATGGTCAATGAG. Internal left primer: ATTCCCACGTGGAGTCAGAA. Internal right primer: AAGTTGTTTGAAATGCCGCT. Internal WT amplicon: 2020 bp. Deletion size: 1162 bp. Deletion left flank: CGTCTCACCTGATTTCGCATGGTTAAGAAC. Deletion right flank: CTTCGAATCTTTTGACTGCTTCAATGTGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y116A8C.20. External left primer: ACGCTGTAAAAAGAAGGCGA. External right primer: TGAGCACGTTTTTGAAATGC. Internal left primer: AGCGGCTGAAGAGAAGTTTG. Internal right primer: GACTGACGCAGTGACAGGAA. Internal WT amplicon: 1414 bp. Deletion size: 378 bp. Deletion left flank: ATGGGCGGAGCTTCCCGATCAATAATTGAC. Deletion right flank: CAATTACCCTCCATCCCTTTCACATACATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C39D10.7. External left primer: TTTGCATGTATCCACGGTGT. External right primer: TAAGCAGCGGAAACCATTTT. Internal left primer: GGGGCACATGAGGAAATAAG. Internal right primer: TTTCAAACAAAAATTCCCCC. Internal WT amplicon: 1179 bp. Deletion size: 691 bp. Deletion left flank: CAGATAACTTGTGATTTTGCACAGTCTAAC. Deletion right flank: TAGAGTTGTTGTGAAGATTGTTGATGTGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C04F5.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk686 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGTCAGACCCGCTTTGAGAA. External right primer: CAAACATGGTGCAAGACCAG. Internal left primer: CGAAGAATGCTTGCAAATGA. Internal right primer: TCCTTCGAGCCAGCTGTATT. Internal WT amplicon: 2299 bp. Deletion size: 1150 bp. Deletion left flank: AAGAAACTCTTTTGAGTTACCTCATTTTTT. Deletion right flank: TTTCTCCACGCTACTCCGACACATTATCAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06B8.7. External left primer: TCACAGAGCGATGGTACTCG. External right primer: CCACCTCGAACCGTTTTCTA. Internal left primer: TGCAGATTCAAACCCATCAA. Internal right primer: TCCAACATTCCTTGCGTGTA. Internal WT amplicon: 1163 bp. Deletion size: 540 bp. Deletion left flank: AGCCAACGGCATGCTGGTTATGCTCACCTT. Deletion right flank: TGTGACTTAAGACTTTCTGGCAATGATTCT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T15B7.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2680 homozygotes (late larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTCAGACGTATCTGGTTGCG. External right primer: AATGCAGCAGAGAGCGACTT. Internal left primer: ACAACGTGTTACAAATTTTAGGG. Internal right primer: GACTCCTCACGGATGACGAT. Internal WT amplicon: 1144 bp. Deletion size: 925 bp. Deletion left flank: TAATTTAAATTAATTTCAGATGGTCTGCAA. Deletion right flank: TATAAATAATAACACCAATATATGAGATTC. Insertion Sequence: ATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F02D8.2. External left primer: ATCAATGTCCGCCAGCTTAC. External right primer: ATGTCCATCATGCACTCCAA. Internal left primer: CGGAATTATAATCCTCCGCA. Internal right primer: AGCCGGATACATTTGAGTTCT. Internal WT amplicon: 1104 bp. Deletion size: 597 bp. Deletion left flank: TCATATGCTATGCCAAAATACGCAGTTGCT. Deletion right flank: GGAAAGGTATTATTCACATATCTACTTATC. Insertion Sequence: TCCCAATATGCAATGGTTCCATATCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y73B3A.5. External left primer: TTCGTCAAAGTCAGTCAGCG. External right primer: AGGGCACTTTTTGTCTGCAC. Internal left primer: GAGAGCGTGCCATATTGGAT. Internal right primer: ACTACTGACGCCCACACTCC. Internal WT amplicon: 2261 bp. Deletion size: 697 bp. Deletion left flank: TATGTTTTTCTAAAAGTAAGATTCATTTTC. Deletion right flank: GATTTTCTCGACGATTTTTGGATTTTCAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y71F9AL.17. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2824 homozygotes (embryonic or early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTTTGACTTTTGCCCCCTT. External right primer: TCAGCAAGGATGTTGCTCTG. Internal left primer: AGCTGTCTGGAAATGTCCGT. Internal right primer: CTCCGTTACCCACAACCATT. Internal WT amplicon: 1146 bp. Deletion size: 766 bp. Deletion left flank: TGACAAGCTTATCCGTATTTCCAGTAACAA. Deletion right flank: AGCCGTGTTGATATTCTCGAGTTTGCGAAG. Insertion Sequence: GATACAAAAACGAGAGCTTCTCAAAGTTTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H37A05.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2761 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTACACACTCGGCGGTTTT. External right primer: TGTGTTAATTGGCACAGGGA. Internal left primer: TCAATTTCAACTGGATTCGATG. Internal right primer: AATCCTGCCACACTTTCAGG. Internal WT amplicon: 1279 bp. Deletion size: 518 bp. Deletion left flank: CTCGGTCTCAGCAGCGAGAACTGTAAGATC. Deletion right flank: GCTCTACGACAACCACATCGATTGCTCCTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T10B5.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2788 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTTTTCGGCAAACTGCAAG. External right primer: AAAAATTGGAATCGGCTTGA. Internal left primer: GCCATTTCTTTGTTTTCAACG. Internal right primer: AAGCCCTGCTTGATTTCCTC. Internal WT amplicon: 1147 bp. Deletion size: 642 bp. Deletion left flank: AACGACACCACATTCTCGGTCAGAGCCGCG. Deletion right flank: AAACTAAGCTCAAGTCAGCTATTGAAATCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T25G12.4. External left primer: GGGGAAAGTGTTCACTGCAT. External right primer: GCGTTGCTTTTCGTCTTTTC. Internal left primer: TCTTTTCCGTGCCTTACACC. Internal right primer: TCCCCATCATTTTTCGTGAT. Internal WT amplicon: 2461 bp. Deletion size: 847 bp. Deletion left flank: TTATTTTGTCTCGTGTTCGTGTTCCTCTTG. Deletion right flank: ATGTAATCATCATGTTGGTCGGCAACAAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K07A1.13. External left primer: TTACGCGATGCGATTCAATA. External right primer: GACGACGGGCATCTGTAAAT. Internal left primer: CCAATTATTCCAATAAATACGAAAC. Internal right primer: GTGGTTTCATTCTCGTATCTCAG. Internal WT amplicon: 1198 bp. Deletion size: 516 bp. Deletion left flank: TCTCGTATCTTGCCATGTAGATGTAATGCA. Deletion right flank: AAAGTTTTGAGTTATTTCATATCGAGCGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M01G12.1. External left primer: CTGCTGCGTTTTTCGTATCA. External right primer: AAGAGCGAATGGATTTGGTG. Internal left primer: TCAGTCTGATCATTTTTCCTTCAA. Internal right primer: TGATTGGTCGGTCATTCAAA. Internal WT amplicon: 1166 bp. Deletion size: 532 bp. Deletion left flank: ACGTCGATTGCTTTTTGACTTCGCAGAAAT. Deletion right flank: ACAAAGTGGCACAACTATAAAAACGCCAGGAAGCACTATTTGCATGACTAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807