Search Strains

F55D12.4. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2822 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATGACATGTCGGTTGGGATT. External right primer: GCCGAGAATGAGGAATTCAA. Internal left primer: GAGACGGGGGCATACTGTAG. Internal right primer: ACCACGTGGATTTTCATTCG. Internal WT amplicon: 1112 bp. Deletion size: 492 bp. Deletion left flank: ATCAAGGAGACGGGGGCATACTGTAGGTCA. Deletion right flank: AAACCTTATGTCAAAATTTTTTTTCTGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11C3.2. External left primer: CCCATTCACATTTTCAGGCT. External right primer: TGCCGCACACCAATAATAAA. Internal left primer: CCGGCGAAATAGGAAATGTA. Internal right primer: ACTTCCTGCGGAAGAAACCT. Internal WT amplicon: 1145 bp. Deletion size: 741 bp. Deletion left flank: AAGATACTATCATTCCAGTGAGTATAAAAC. Deletion right flank: TTTGTTCGCGGAATTTTGAGGCTGGAAACT. Insertion Sequence: TATTTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34D1.1. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 384 bp. Deletion left flank: CTATTCAAGAGAAACTCTAGAGGATCGCTT. Deletion right flank: AGTTTAAGAAAAATAAAGTAAAAGAAACTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11C7.3. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F16B12.6. Identified by PCR, validated by CGH. External left primer: CGATCACCAACAAACAATGC. External right primer: TACGTGACCCGTTGACAAAA. Internal left primer: CAGTTTAGAAATGCCTCGCC. Internal right primer: CGGACCGTCGTAAACAAACT. Internal WT amplicon: 2674 bp. Deletion size: 2358 bp. Deletion left flank: ATTGTGAAAACAAAAAAAAACAGATGAAGC. Deletion right flank: GCAATTCTTCAATCATTTCAGGTTTTCTAT. Insertion Sequence: AGATGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K01G5.5. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2795 homozygotes (early larval arrest, Dpy or Dpyish). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAACTTCCATCCTCGAAC. External right primer: CCTCCTCCTCTTCCTCGTCT. Internal left primer: CGCACCAATCACTACACACC. Internal right primer: GGCGTCTCCTCTTTCTTGAC. Internal WT amplicon: 1149 bp. Deletion size: 997 bp. Deletion left flank: GGGAGTATCACCATTAAAGCGTGACATCAA. Deletion right flank: ATTCGGAAAACCAAATGACACTACTCCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54C9.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2829 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAACCGCCAACGAGTACAAT. External right primer: CAACGGGATCATTGCTAGGT. Internal left primer: GCTAAAGCTGCCGTAATTGG. Internal right primer: TGGATTACCTCCACCACCTC. Internal WT amplicon: 1183 bp. Deletion size: 642 bp. Deletion left flank: TGCTTGAGTTACAAAAACTCCTCCTTGAAG. Deletion right flank: TCATTAAAACTTACAAGAAAGCAACGACAC. Insertion Sequence: TTAAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK669.4. Strain might be sensitive to hypochlorite; no survivors after mutliple attempts to clean by hypochlorite treatment. External left primer: TAGAGTGTTGAAAACGGGGG. External right primer: CCACACCAGCAGTTCGTAGA. Internal left primer: CATCAAGGGATAATTGGGCA. Internal right primer: GGAACTGGAAAAGACGGAAG. Internal WT amplicon: 1181 bp. Deletion size: 401 bp. Deletion left flank: TGTCATGTTTATCGAATCGTGGGAGTTTTT. Deletion right flank: CATTTTCCATTTTCTCATCAGTTGTAGAAT. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

B0261.2. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3018 homozygotes (late larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTCCGCTCCAGCTACAAAT. External right primer: ATCGAGCTTTGCTGTTTCGT. Internal left primer: AGGGATTGATGCTGCAAGAG. Internal right primer: TTCGGAAATCGTTCCAAAAC. Internal WT amplicon: 1186 bp. Deletion size: 664 bp. Deletion left flank: GAGCCGGTATCTATCTCATCGTGTGCTTAG. Deletion right flank: ATTCGAACTCATCAGATGTGAATCCTCACA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34D1.1. Identified by PCR, validated by CGH. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 265 bp. Deletion left flank: TACGCACCTTTTGTGTCCCTTCAGGCGTGA. Deletion right flank: AGAAAAATAAAGTAAAAGAAACTGGAAAAT. Insertion Sequence: ATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y116A8C.17. External left primer: AGCGAGCATTGCAAAAAGAT. External right primer: TATGAATGTCCGTGCTCTGC. Internal left primer: AAGAGCTGAGCAATGCCAAT. Internal right primer: ACAGCGTTTGTTCCGTATCC. Internal WT amplicon: 785 bp. Deletion size: 94 bp. Deletion left flank: AATTGACACCTGGCTCCGTACTTGCAATAT. Deletion right flank: ATTTGCATGCTTCACCGTAAATGCATGTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F07D3.2. External left primer: ACTCCCCCTCATCCAAATTC. External right primer: TTTCGCGAATGAAGCTATGA. Internal left primer: CCCCACGTTACCAGATGATATT. Internal right primer: CCAGTTGGTCCTTACAAGAGC. Internal WT amplicon: 1129 bp. Deletion size: 421 bp. Deletion left flank: TATGTTTTTCTGTTCAACGTTTTTTATTTA. Deletion right flank: GTGGAAACCCAATGGAAATGGAAAAACGGA. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C50F4.6. External left primer: GATGATGACGAAGAGCAGCA. External right primer: ACAATTCCAGGTGGACAAGC. Internal left primer: CGGAGCAGAATAAGGAGCAG. Internal right primer: CAGCTAGCGAGGCAAAATCT. Internal WT amplicon: 1145 bp. Deletion size: 355 bp. Deletion left flank: GCAGCAGCAGTCATCCAGTTCGAAGAGTAC. Deletion right flank: AACTCATTCGCTTTCGTTTTCTAACAACTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K11D2.5. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok3030 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: GTTGGCAAATTTTTGATGGC. External right primer: ATTTTCCGCTCGGAATTTTT. Internal left primer: TCTTTCGTGCTTCCAGCTTC. Internal right primer: TTTCTCGTTGATTTTCCCCA. Internal WT amplicon: 1208 bp. Deletion size: 605 bp. Deletion left flank: ATTGGTGGATTTTTCTCCAGAAAGCAGGTG. Deletion right flank: TTCAAAATTTTAGGTCTTGAAATTTCTAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1120) in Y52B11A.9, detectable by PCR using the following primers. External left primer: CAATCCCCTCTCTCATCCAA. External right primer: TATTTGCAACGACACTCCGA. Internal left primer: TGCATATGACGCTCTTCGTC. Internal right primer: TTCCAGCTTCTGCCAAATGT. Internal WT amplicon: 1563 bp. Deletion size: 405 bp. Deletion left flank: GGAGCTTTTCGGCTCAAATTATTGGAATAT. Deletion right flank: ACAAACTACAAAATTTCTAGCCTCTACCAA. Validation: gk1120 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y116A8C.4. External left primer: CGACGTTGTTTCCAGGATTT. External right primer: TTCCACCCAACTCACATTCA. Internal left primer: GCGCTGAGCTCTCAAAGACT. Internal right primer: GACAAGCCCCATAAAGTCCA. Internal WT amplicon: 1215 bp. Deletion size: 526 bp. Deletion left flank: TGTATCACGCTTGCTCATCAATTGGTAGGA. Deletion right flank: TTTCTTCAAATAGTTATTTTAGAAATGCTC. Insertion Sequence: TCGACATCTTCCGGGTTTCCAGACCCATAAAATGTCGGTTGCTAGATAATAAATCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK455.7. External left primer: GCGAATGCTCTTATGGAAGG. External right primer: TTGCAAATGAACTCGTGAGC. Internal left primer: CGTTATGCGAACGACGACTA. Internal right primer: ATTCGGATGTTTTCAGCGAC. Internal WT amplicon: 1151 bp. Deletion size: 609 bp. Deletion left flank: TTCGATGTATCTATCAGCGAAGCATCTGAA. Deletion right flank: GCTTGTTGGGCATTCTGGATGTGGAAAATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y113G7A.8. Heterozygotes are WT and segregate WT, sterile adults (gk173 homozygotes) and UncRol progeny. Well-balanced; gk173/unc rol heterozygotes occasionally roll and are not necessarily recombinants. Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1128) in W02D9.3, detectable by PCR using the following primers. External left primer: ACGGATTTTGCCACTTTGTC. External right primer: CATCACATTTCTCGTGGTGG. Internal left primer: TTGGAGAGGTGTGAACGTAGAA. Internal right primer: TTTCTAGGCCGTACGTTGCT. Internal WT amplicon: 1621 bp. Deletion size: 1315 bp. Note: internal left primer binding site deleted in gk1128; major deletion product from nested PCR runs at about 650 bp. Deletion left flank: GCAGAAAAAATTTTGGAATTTGAGCTACAT. Deletion right flank: CATTTTCTTGCAGAAAAACGTGCAAAATTC. Validation: gk1128 passed by CGH. Other deletions (gk3217, gk3218) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34D1.1. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 571 bp. Deletion left flank: AAAAAGGAAAACGGTGTTTTCTACTACCAC. Deletion right flank: GTGAGTGCTGGAGGAGGTTGTTTTTCGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y37F4.6. External left primer: CAGAAGTTTGTGGGTTCGGT. External right primer: ACCTGCCTACGTGCCTAGAA. Internal left primer: ACTCCATATCTCCGCAGGAA. Internal right primer: TCCTGGTCCATCTTCGAGTT. Internal WT amplicon: 2083 bp. Deletion size: 990 bp. Deletion left flank: TGAACACTTTTTTGTAAAAAATTTGGTTGC. Deletion right flank: CACGAGGGGCGTGGCCAACGACAATGATTG. Insertion Sequence: CGAGTTGGAACCAATTGATTTGAGCTTCATTATTTTTGAATATTCTAAATAGTTAAAGG TCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34D1.1, B0462.4. The allele gk1133 was identified by PCR, validated by CGH, and can be detected with the following PCR primers. External left primer: AGGCTGACGGCTTCTAATGA. External right primer: GCGGTAGTGCATTCCAATTT. Internal left primer: GATGGCTGGAATGTTGGAGT. Internal right primer: GAGACATGCACACTAGCCGA. Internal WT amplicon: 1370 bp. Deletion size: 337 bp. Deletion left flank: TTTTTTTCAGATATTTAGGTTAGTCCACTT. Deletion right flank: GGGCACGCCCACTTTATACTATTTTGATGT. Insertion Sequence: TAT. The allele gk3031 was identified by CGH and not confirmed by PCR. Left flanking probe: TTATAAACAGAGACAAATTTAGACCAAAACTCTGTAGGAAAGTGAGTTTT. Right flanking probe: ACAGGAATATGAATTGAGTGATTGCTTGTGGTAGACTCTGTAGATGGTCT. Left deleted probe: AAGTGAGTTTTTCCGTGTGTTCTGTGGGATCAGGTGCTCCAAATCTTCCA. Right deleted probe: GCGCCAATGCTAATATTATACTTATATAAAAGCACTTAACAAGCTGAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T05C12.1. External left primer: TTCCCGAGTATAGTCCCGTG. External right primer: CATGTGGATTGATTGTCCCA. Internal left primer: CAAGCAAAACGGTCATCAGA. Internal right primer: TGCTCATCTTGTTTCTTTCATTTT. Internal WT amplicon: 1144 bp. Deletion size: 531 bp. Deletion left flank: GATGCAAATGCTTGGAAAGAATATTGGAGA. Deletion right flank: TTCGTCCAGCCAACACTCCGGATTATACCA. Insertion Sequence: GAAATAGGAAAGAATATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F52H3.4. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2786 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTAGCGAAGCATTTTTGCCT. External right primer: CGACCCGAAGAATTGACATT. Internal left primer: GGAAAAACGCGACTGTCAAT. Internal right primer: CACGAAAATTATCGGGATGC. Internal WT amplicon: 1138 bp. Deletion size: 467 bp. Deletion left flank: AGTTCATGCAAGACTGAACAAGAAGACCAC. Deletion right flank: CTGAAAGTGTTTCAAGAAGGCATGGTATCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F43H9.2. External left primer: TGAATACCCGGGAACTCGTA. External right primer: GAATAGCCAACGGATGGAGA. Internal left primer: CGTTGGATCCTATAATTATCTTGG. Internal right primer: GGCCGAAATACAGAATCGAA. Internal WT amplicon: 1128 bp. Deletion size: 572 bp. Deletion left flank: GTGCAGAACAATCAGCTTCCAGTATTGATA. Deletion right flank: CTGGAAAGGGAGTCGTTGAGTATTGGGGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K06A5.2. External left primer: CCATCGGCCTAAGCGTATAA. External right primer: TCAGCATTTCCTTCCAATCC. Internal left primer: AAAATGACGATGAGCGATCC. Internal right primer: TGCTCTTCGGAAGCAGAGAT. Internal WT amplicon: 1135 bp. Deletion size: 667 bp. Deletion left flank: AGCTGGTATTGACATTGCAATTGCTGTATG. Deletion right flank: CAGTGATGAACCCGACTTGTAAGTTGCTTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T24C4.1. External left primer: CGTGCTGGTTCTCGTTATGA. External right primer: CATATGCAGAGATGGCGAGA. Internal left primer: TCACTCAGCCTGGACTTGTG. Internal right primer: TTCTGGACCGTTGTAGAGGG. Internal WT amplicon: 1135 bp. Deletion size: 415 bp. Deletion left flank: GAATTGTGTTTGAGGATATTCATCGCGCTG. Deletion right flank: CTTCTCCACTGAAATTTGCATCACTTCCAG. Insertion Sequence: TTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F40B5.3. External left primer: CAGCTCGGTTTCACAGGATT. External right primer: CCGGGACAATAACTCCAAAA. Internal left primer: GTTGGACACGAAATTGGTCA. Internal right primer: CCAATCGTGCAAGAGCAATA. Internal WT amplicon: 1182 bp. Deletion size: 862 bp. Deletion left flank: ATCATTTATTTAGGAAAGAATTGAGCGCCT. Deletion right flank: AACATATTGCTCTTGCACGATTGGATCATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1178) in F11E6.8, detectable by PCR using the following primers. External left primer: ACATATTCGACAAGGCACCC. External right primer: CACCCTTCGAGTCTACCCAG. Internal left primer: GCGAGTGAAAGGATCTGGAG. Internal right primer: TGGTGAGGGAATTGGAAAGA. Internal WT amplicon: 2406 bp. Deletion size: 1746 bp. Deletion left flank: ATTTTCCCATTTAGGTATACAAAACTTACA. Deletion right flank: GAGGCAAACTTCTCACTTCTTGAAACATTT. Validation: gk1178 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

attf-5 homozygous viable deletion, detectable by nested PCR. ceh-90 homozygous viable deletion, identified by CGH. gk1279: External left primer: ctcccgaaaatccagcatta. External right primer: aactcatggaaaccgtcctg. Internal left primer: ccatagcaactgcgatgatg. Internal right primer: atgagcattagagcgcgatt. Internal WT amplicon: 2677 bp. Deletion breakpoints not determined; deletion of approximately 1030 bp narrowed to 1142-bp region between X coordinates 788497 and 789639 (WS279). Validation: gk1279 confirmed by CGH. gk3396: Left flanking probe AACAACAAACCTGAGCTTCGTTTCGATTCAATAAACCAGCAAGACGATTC; left deleted probe: ATAAACCAGCAAGACGATTCATTTCAGAAGTTCCAGGGTGTGAGTCTTTT; right deleted probe: ACAAGTTTTTCGGATGGAGAATTACCTAAAATGTCGATGAAAGATTATTG; right flanking probe: ATTGAGAGATAGAACCATAGAAAACACTAAATACGCAGATAGGTTATCCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M01D7.6. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F32E10.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2965 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGAGACATGGCACTTTCAGA. External right primer: TCCAAATCCGAAGCCATATC. Internal left primer: GGATGTTGGCTGACTCCATT. Internal right primer: CAGAGTCGGATGCATCATTG. Internal WT amplicon: 1188 bp. Deletion size: 334 bp. Deletion left flank: TGTCGTTGCTTCTATGGATTCTAGAATGAT. Deletion right flank: CTATACAACAAAGCTCAAACACAAATGCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y105C5B.2. Identified by PCR, validated by CGH. External left primer: GCCGCAATTGTATTCTCCAT. External right primer: AATTCCCTGTTCACAGCGTC. Internal left primer: TATGTAGGGAATCGCGAAGG. Internal right primer: CTCTTGCTTCGAAACCCAAT. Internal WT amplicon: 2288 bp. Deletion size: 1832 bp. Deletion left flank: TCGATTTTTTCGGGAAATGTTGCGGAGCAC. Deletion right flank: ATTCTCAAAATTAGCTCTTTCAGTTCGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14A4.13. Identified by PCR, validated by CGH. External left primer: CACCTTTCCCCATGAAAATG. External right primer: GTCGCCAATGAGACGAATTT. Internal left primer: GCAGCAGTAGTGGCAGTGAA. Internal right primer: TTTCCCGAAGAAGAACGATG. Internal WT amplicon: 2574 bp. Deletion size: 1569 bp. Deletion left flank: CGATTCGCTTGCAAAGCTGAGCTCGCAATT. Deletion right flank: TACCAAAGTCCCACCTGCTCATTAGATTGA. Insertion Sequence: TCGGTTTAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K10D2.4, K10D2.3. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2756 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 547 bp. Deletion left flank: TCACTTGCAAGACAGTGTGGCTATTCTGAC. Deletion right flank: AGAAACGCCACTTTTATTTATTTATCAACT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T16H12.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2764 homozygotes (late larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACTCGCTCGATTTGTTCGTT. External right primer: TCGAGGAGCCTTTTCACATT. Internal left primer: GACGCAAATTCGAGAAGATTT. Internal right primer: TGACACTGTCGAATAAGGCG. Internal WT amplicon: 1149 bp. Deletion size: 613 bp. Deletion left flank: TCGTTCGACGCAAATTCGAGAAGATTTTGT. Deletion right flank: TTCGAAACTTTATCGAGAGAAACATTGAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F54B3.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3093 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CCGGAAAATCTGTTTTGCAT. External right primer: CGTAATCGAGTCCGGAATGT. Internal left primer: CACCATCCCAAGCTTCAATC. Internal right primer: CGAAAAGTGTCTTTCCGGTT. Internal WT amplicon: 1152 bp. Deletion size: 391 bp. Deletion left flank: ATGCAGGAAGAAAGCCTCCGAAAACAAGAA. Deletion right flank: TCACTCCACTTGAAGTACTCAAACACCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y39G10AR.5. External left primer: GCTGAATTCTCCGGCTTAAA. External right primer: TAGCCAGAGCCCGTGTAAGT. Internal left primer: CATCAAGATAAACCGGCAAA. Internal right primer: CACGTTTCGAGGTGTCGTTA. Internal WT amplicon: 1126 bp. Deletion size: 767 bp. Deletion left flank: AAGAAGATTTCTCAGAACTCTGCGATTCCT. Deletion right flank: AGAAAGGTTTATTTTTTGAAAAGTTAACGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y54E5B.4. External left primer: AAGTTGTCGGAATTGGTTGG. External right primer: TTGCGATTCGAAGAGAGCTT. Internal left primer: CATTGTTCAATATGCACCCAA. Internal right primer: TGGCCACAAAGAAGAAAAGG. Internal WT amplicon: 1138 bp. Deletion size: 684 bp. Deletion left flank: AATTGATGACGCTATTTATGTGAGAACGTG. Deletion right flank: AACGGCACACTGCCGGAATTAAAATTTCCG. Insertion Sequence: TGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T13A10.11a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F42A6.9. External left primer: TCTCAGCTCATCGGTACCCT. External right primer: CCTTATGGTTAGGGCCACCT. Internal left primer: CATAACTCGGCTCCCTGCTA. Internal right primer: GGCCTAGGAATCTCTTACACAGTC. Internal WT amplicon: 1124 bp. Deletion size: 702 bp. Deletion left flank: GTTCTCAATGGTCGCCTTCAACTGTGTCAT. Deletion right flank: GTTTTCGATAGCTTGCCGGCCTGATGGATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F01D4.6. Identified by PCR, validated by CGH. External left primer: CGCGTTGAAGTCAGTTGTGT. External right primer: GACTCCTGTTGGATTGGCAT. Internal left primer: CTGCCACATCAGTGTTGCTT. Internal right primer: CAAAGCCTCTCAGTGCGATT. Internal WT amplicon: 2450 bp. Deletion size: 774 bp. Deletion left flank: GAGCAAAGCGTAAAAAATGATTACATCTTT. Deletion right flank: TTTTACTTGACTCTCTGAAAGTCGAACAGA. Insertion Sequence: TTACTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

This strain is homozygous for a deletion (gk1048) in T11A5.1, detectable by PCR using the following primers. External left primer: TAGAGAGGGCACGCAGTTTT. External right primer: AGTCACGCACTTTGTGTTCG. Internal left primer: TTTGGCGTTGTTTCTCAATG. Internal right primer: AACAAATTGCCGAGTTGGAG. Internal WT amplicon: 1826 bp. Deletion size: 308 bp. Deletion left flank: AATTATGGAACAATAAATAATAAATGACTT. Deletion right flank: GACCGCTCCGGTGAAGGCTTCCTTTTCTTT. Insertion Sequence: CGTCCTCGTCACTA. Validation: gk1048 passed by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1127.4. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1940 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAAAATGGATTGCCGAAGA. External right primer: GGGAAGTTCGTAATCGGTGA. Internal left primer: TTTCAGGCCAAATGTCCTTC. Internal right primer: CTGACAGCTCACACCACGAT. Internal WT amplicon: 2174 bp. Deletion size: 1250 bp. Deletion left flank: TGGAAGCATTCGTGAAGATTTGTCCGGCTT. Deletion right flank: CCTTCACGGTTGGCCCTGCTTTGAAGCTTG. Insertion Sequence: AGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

W03F8.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok3139 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTCGATCTCGAAAAATCGG. External right primer: CTTTCGGCTTTCTGTCCAAA. Internal left primer: CTAACCTCACCCGTGGAGAA. Internal right primer: CCTGAGTATTGTTGCCAGAATTT. Internal WT amplicon: 1143 bp. Deletion size: 536 bp. Deletion left flank: TCCCGTTGGATGGGAGAATATTCAAATTAC. Deletion right flank: ATGGATTCGGACCATCTGGATGTAAAAAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C44C8.6. The gk1110 deletion allele in this strain was identified and isolated using PCR, and its breakpoints were determined by capillary sequencing of PCR products. Its presence was confirmed by the Vancouver Gene Knockout Lab by CGH (comparative genome hybridization). External left primer: ACTCTGTGCCACCAAAAACC. External right primer: CATATCCGTCCATTGTTCCC. Internal left primer: TGTCCTGCTTCAGTTTCCCT. Internal right primer: CATTGGTTGTCCGTGTTGAG. Internal WT amplicon: 1976 bp. Deletion size: 1024 bp. Deletion left flank: GAATTTTTAAATCAAAACTATTTGTTCCAA. Deletion right flank: GCGTATGACTAAGTCTATGCCTAAGCCTAA. Insertion Sequence: T. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F11A1.3, F11A1.2. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F25H8.6. Identified by PCR, validated by CGH. External left primer: CAGAGGCTCAGTTTCCGTTC. External right primer: GGTTTGGATGAAGGGGATTT. Internal left primer: TGCCAGACTTCAAACACTCG. Internal right primer: TGTGACCACGGACAGAAGAG. Internal WT amplicon: 2425 bp. Deletion size: 946 bp. Deletion left flank: GAAAATTGAAGATGATCATAAAATTCATAT. Deletion right flank: ACAAGACTGAATGGGAATTTGAGCCACCGC. Insertion Sequence: TGCCTTTGTTCGATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M05B5.6. External left primer: CAAAGGCGATGTCATTTGTG. External right primer: CTCGTCCAACTCACACCAGA. Internal left primer: AAAGCTGAACCAGGATTTTATGA. Internal right primer: TCCGGGAAATAAAGAGAAGGA. Internal WT amplicon: 1127 bp. Deletion size: 478 bp. Deletion left flank: GGCCATTTCAGATGAGGTAATATTTTACTT. Deletion right flank: GGATATTTGGACATTTGAGTTCCCCAAAAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F56A6.2. External left primer: CCTAAGAAACAGTGGCCGAG. External right primer: TTGACGAGGTTGATGAGCAC. Internal left primer: TTGACGTCACTTCTCTTCCAGA. Internal right primer: CAGGACCTCTCTTGCTAGGC. Internal WT amplicon: 1199 bp. Deletion size: 653 bp. Deletion left flank: CGAACTTTGTAAGATTCACAGCATGAACCT. Deletion right flank: ATAATTTCTACTTATATTCAGTCATATAAA. Insertion Sequence: AATAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807