Search Strains

More Fields
Strain Species Genotype Add
VC2129 C. elegans T19B4.1(ok2681) I. Show Description
T19B4.1. External left primer: GGCATGTAGGCAGACAGTCA. External right primer: CAAACCTTGCATCCCAAACT. Internal left primer: CAGTTGCATTTGAACCGATG. Internal right primer: TTCCAGCTCTTTGGAAAACG. Internal WT amplicon: 1163 bp. Deletion size: 519 bp. Deletion left flank: CAAGATGGAATAAAATATTTTGTGCTCCAA. Deletion right flank: AAATCTAAAATAGTCAATTTTAAGAAAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2133 C. elegans C11E4.7(gk3221) dhhc-1(gk1067) X. Show Description
This strain is homozygous for a deletion (gk1067) in F09B12.2, detectable by PCR using the following primers. External left primer: TGGTGGAGGTTTTCAAGGAG. External right primer: GCGTCATGGTGGGTAAAATC. Internal left primer: AAAGTGAACAGCGAAACGGT. Internal right primer: TAACTGGCAGCAGTGGTGAG. Internal WT amplicon: 1907 bp. Deletion size: 502 bp. Deletion left flank: TATAAGCCTGGCTGAAAGTTACGAATTTGG. Deletion right flank: AAAATTTGAATGAAATGTAAAGTTGAAGTA. Validation: gk1067 passed by diagnostic PCR, CGH. Other deletion (gk3221) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2138 C. elegans kcnl-2(ok2818) I. Show Description
F08A10.1. External left primer: TTTCACAACTACCGCCCTTC. External right primer: AAAAAGAAGCGAACGAACGA. Internal left primer: GATGATTGGATGGTTGCCTT. Internal right primer: CCGACGTGATGATTACGCTA. Internal WT amplicon: 1193 bp. Deletion size: 546 bp. Deletion left flank: CTTCCAATCGAGTTCATAGCTCCATTTATG. Deletion right flank: AATTTCATGCAAGACACTCAACTTACTAAG. Insertion Sequence: TTTTCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2141 C. elegans C27B7.7(ok2868) IV. Show Description
C27B7.7. External left primer: CATGACGTCGGTTACACTGG. External right primer: CTCCGGGTCCTGAAACATTA. Internal left primer: GCCAAATCTGTTTGAAGAACTG. Internal right primer: GCATGGATTCGTGTCTTCCT. Internal WT amplicon: 1144 bp. Deletion size: 409 bp. Deletion left flank: CTCTTTTCTAAAATAAAATATTGGTGTTCA. Deletion right flank: TGGAATATTTTGAAGTTCTCTCTTATAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2142 C. elegans gpd-3(ok2870) X. Show Description
K10B3.7. External left primer: ATGACGGACAATCACAACGA. External right primer: GAAACTGCTTCAACGCATCA. Internal left primer: GGCCTTGGTAGCAATGTAGG. Internal right primer: GACCAAGCCAAGTGTCGG. Internal WT amplicon: 1117 bp. Deletion size: 851 bp. Deletion left flank: TGACAAAGTGTGGGTTGAGTGAGATGGATG. Deletion right flank: TGAGTGGAATCGTACTGGAACAAGTAGACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2143 C. elegans F54D5.3(ok2891) II. Show Description
F54D5.3. External left primer: TTGGCTTTGCAGGAGCTAAT. External right primer: CAAAATGCAGCGAAAAACAA. Internal left primer: CACCGATGACACTGGTCACT. Internal right primer: CAATTTGGCCGGAGATTTTA. Internal WT amplicon: 1165 bp. Deletion size: 455 bp. Deletion left flank: CTATTTAATAAGCTTCGTTACCAACTTCTG. Deletion right flank: CAAGGTTCGAATTGGATTTTTTTTAACTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2148 C. elegans F23B12.4(ok2848) V/nT1 [qIs51] (IV;V). Show Description
F23B12.4. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2848 homozygotes (Dpy hermaphrodite, strongly Him, males more WT. Healthy gravid WT non-GFP segregants are recombinants and not true homozygotes). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCCGCATTTGAAAGTATGA. External right primer: AAGCAAAAAGCAATGCAGGT. Internal left primer: GCAGTTGAACATCAGGGAGG. Internal right primer: GGACGCCTACGCACAATACT. Internal WT amplicon: 1145 bp. Deletion size: 396 bp. Deletion left flank: TACTACTTGAAAATGCTTCGTTAAAAATGA. Deletion right flank: GGAACTTCTAACAACAATTATATTCGACTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2149 C. elegans T12G3.1(ok2869) IV. Show Description
T12G3.1. External left primer: AGGAAGAGTGTGCGCCTTTA. External right primer: AATTCAGCAGAGCTGGCTTC. Internal left primer: TGTCAACGGACCAATCTTTG. Internal right primer: CTTCTTGTTCAAGACGGGCT. Internal WT amplicon: 1199 bp. Deletion size: 406 bp. Deletion left flank: CCACTCCAGTTCCATTCCCTCCATCTCCAA. Deletion right flank: GAAATCTGCCGAGAGACTATTCACAATGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2150 C. elegans C06B8.7(ok2814) V/nT1 [qIs51] (IV;V). Show Description
C06B8.7. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2814 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCACAGAGCGATGGTACTCG. External right primer: CCACCTCGAACCGTTTTCTA. Internal left primer: TGCAGATTCAAACCCATCAA. Internal right primer: TCCAACATTCCTTGCGTGTA. Internal WT amplicon: 1163 bp. Deletion size: 680 bp. Deletion left flank: GCTTAAAGCAGGAGAGACCAAAGCGTGCTT. Deletion right flank: TCTCCGAATGATCGTATCACACTGGCCAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2168 C. elegans ZK337.1(ok2874) I. Show Description
ZK337.1. External left primer: TCCAGACGTGCTGACAACTC. External right primer: GGCGCTACTCCACCATTAAA. Internal left primer: TCAGCTTTTGGCGATAGTGAT. Internal right primer: GTCTTCCATGGCTGTGAGGT. Internal WT amplicon: 1142 bp. Deletion size: 360 bp. Deletion left flank: TCTCTCTCAATTATTCGTTGGTTAGTATCC. Deletion right flank: AAGTGGGCTTTTTTCAAATTTTTTCAAGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2169 C. elegans abu-15(ok2878) V. Show Description
C03A7.4. External left primer: GAACCGGTTTACTGAGCAGC. External right primer: GTTAGCTTGGCAAGAGCAGG. Internal left primer: TATTGCGTTCCTTGCATGTG. Internal right primer: AGTTGCTGGTTGAGCAGCTT. Internal WT amplicon: 1101 bp. Deletion size: 793 bp. Deletion left flank: CAATCCGTGAAAAGAGACAGTGTGGATGTGCTCAGCCACAGCAGAGCCAATGCTCGTGC CAACAAGTTCAACAGACTCAGTCATGCTCGTGCCAATCTGCTCCAGTTCAACAACAATC CCCATCCTGCTCATGCGCTCAGCCACAACAAACTCAACAAGTTCAGGTACAGTTCATTA ACATATTCGCAAACCATTAAATCAAAAATTTTAG. Deletion right flank: AAACTGCCTGCCAATCATCATGCTCTAACTCA. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2172 C. elegans C07G1.2(ok2531) IV. Show Description
C07G1.2. External left primer: TCGTGGCAATTGACTGTGAT. External right primer: CGCCGAATATGATGATGATG. Internal left primer: TTTTTGTGAATCTGGAAGAGAATG. Internal right primer: TTACTCACCCAAATCCGAGC. Internal WT amplicon: 1139 bp. Deletion size: 346 bp. Deletion left flank: TTATCCCAATGTTACATTCCACCATGTCCA. Deletion right flank: CTTCTGCTCTAACTAGCTATTTCTATTTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2175 C. elegans klo-1(ok2925) IV. Show Description
C50F7.10. External left primer: TCCGATCGACAGCTAACCTT. External right primer: AAAGGATCCAGTTTGCCTCA. Internal left primer: TTTCTCTCATTGAGGCTGGG. Internal right primer: TCATTCCGTCGATGTCTTGT. Internal WT amplicon: 1104 bp. Deletion size: 592 bp. Deletion left flank: GCCTGCATGTTTATTTCGTTGAAAGTTATC. Deletion right flank: AAAGACATAACCGAACAAGACATCGACGGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2176 C. elegans nhr-110(gk987) V. Show Description
Y46H3D.5. External left primer: TGGACGGTTGAAAACATTGA. External right primer: ACGCCTAGCTCAAAGCAAAA. Internal left primer: TCGCATCAGCTGTTTGATTC. Internal right primer: CGGTCTCAGCTTCTGAGCTT. Internal WT amplicon: 1633 bp. Deletion size: 818 bp. Deletion left flank: AAATTCAGAATATGCCCAACCGAAACTCAC. Deletion right flank: GTTTTGCAAAACCAGCGTCCATCTATTTTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC218 C. elegans dgk-3(gk110) III. Show Description
F54G8.2. Superficially wild type; at low penetrance bursts at vulva. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2180 C. elegans Y17G7B.22(gk1010) II. Show Description
Y17G7B.22. External left primer: CCCGTAGTTCATCGATTGCT. External right primer: AAAAAGAATACCACCGGCCT. Internal left primer: ATCTGTTGCCTTCTGTTGGG. Internal right primer: TCGCAGGAGTTTGGGTACTT. Internal WT amplicon: 2119 bp. Deletion size: 1350 bp. Deletion left flank: AATGGACCTGAAAGATTGAAAACAATTGAC. Deletion right flank: TTTTGGTGCTTCAAAAAACATCAAAAAATA. Insertion Sequence: GTGTGGTAAGCGAAAGTAAGCGAAAATTCAAGCTTCGATTGAATTATCATTTCAAAAAG AAATAAATGGAAAACGTATTGTAATCGCTGAACAAACTCCAAAAAATTTGATACTTTTT GATGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2182 C. elegans spe-17(ok2593) IV/nT1 [qIs51] (IV;V). Show Description
ZK617.3. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok2593 homozygotes (often sterile or nearly sterile, but population can be maintained). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGCTGCACCTAACAATCAGC. External right primer: CAAGCGAACAGCAGTCACAT. Internal left primer: GCTTGAATTTTTGACTGTGGC. Internal right primer: GTTGTCGAATTATTGCGGCT. Internal WT amplicon: 1167 bp. Deletion size: 416 bp. Deletion left flank: AATTATTTCTCACTCTTTGAAATTATCAAG. Deletion right flank: TTAGTATTCTGGATGTTTGAGTGAGTAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2183 C. elegans ncbp-1(ok2787) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F37E3.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2787 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGAAAAATATCGGGCTTCAA. External right primer: CCTTCCAATCTGTCCAGGTG. Internal left primer: GCCATCTATCTCCCAAATCG. Internal right primer: ATTAAACCCCCGCTAAATCG. Internal WT amplicon: 1121 bp. Deletion size: 534 bp. Deletion left flank: CTCAAAATCTTGCTATTTTCCTTTGTGATC. Deletion right flank: GCGGATTGTTCCGCCTTTTCTGTAAGTGCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2184 C. elegans +/mT1 II; rpb-2(ok2893)/mT1 [dpy-10(e128)] III. Show Description
C26E6.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok2893 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGAAGCATGGCAAGAAGCAT. External right primer: GCTTTCTTTTGATCACCCCA. Internal left primer: ATGTGCAGCGAATTGTTGAG. Internal right primer: GACGCAGACATCAAGAGCAA. Internal WT amplicon: 1187 bp. Deletion size: 331 bp. Deletion left flank: GATTATGATTGTGTTCCGAGCGCTGGGATT. Deletion right flank: GGAAACAAAAGACTGGATTTAGCCGGACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2185 C. elegans C06B8.7(ok2814) V. Show Description
C06B8.7. External left primer: TCACAGAGCGATGGTACTCG. External right primer: CCACCTCGAACCGTTTTCTA. Internal left primer: TGCAGATTCAAACCCATCAA. Internal right primer: TCCAACATTCCTTGCGTGTA. Internal WT amplicon: 1163 bp. Deletion size: 680 bp. Deletion left flank: GCTTAAAGCAGGAGAGACCAAAGCGTGCTT. Deletion right flank: TCTCCGAATGATCGTATCACACTGGCCAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2186 C. elegans F41G3.10(ok2840)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F41G3.10. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2840 homozygotes (sickly Unc with small broods, often Dpy, various morphological defects; population can be maintained with difficulty). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GGATCATTCGAGTGGGAAGA. External right primer: GTCCACTAAACTTTGCCCCA. Internal left primer: AAATTGAGGATGGATGACGC. Internal right primer: AAACTCCCACGAAATCATGC. Internal WT amplicon: 1146 bp. Deletion size: 795 bp. Deletion left flank: TGTTGCAATAAGAACGCATAGCTGTACAAT. Deletion right flank: GTGTCTAACTGTGAACGAGTGGGCTTTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2189 C. elegans K10D2.4&cid-1(ok2757) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K10D2.4, K10D2.3. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2757 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 713 bp. Deletion left flank: AGGCTGAAACAACCTTCATTTTACTTTTGC. Deletion right flank: AATGAAGTATATTAGGCCCTTCGTATTGCT. Insertion Sequence: AAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2191 C. elegans Y54G11A.14(ok2884) II. Show Description
Y54G11A.14. External left primer: TCAGACCGGTCATGGTACAC. External right primer: GGCGCTACTCCACTTTTGAA. Internal left primer: AAAACGCGAAACTATCGAAAA. Internal right primer: AAAAACTTACGCCATCGCC. Internal WT amplicon: 1138 bp. Deletion size: 686 bp. Deletion left flank: AAATTCAGGATCTTGGCTCCTGGAACGCAA. Deletion right flank: TTCTTGTGGCGCGAGTTGGATGCGGAGGAG. Insertion Sequence: A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2192 C. elegans lpr-2(ok2915) IV. Show Description
T12A7.5. External left primer: GAAAATATTCGGCCTGCAAA. External right primer: GCACCAGTAGAGAACGGCTC. Internal left primer: CGAGTGCTAACTGTGGTTGC. Internal right primer: GGAATTTGACTGGAAAAGGG. Internal WT amplicon: 1155 bp. Deletion size: 436 bp. Deletion left flank: ATCTATCGAGAACTTCAAAAAGTTTGTGTG. Deletion right flank: TTTTTCAACAAGAATTTATCTTAAACTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2193 C. elegans ddl-1(ok2916) II. Show Description
F59E12.10. External left primer: TCACAAGTTCTGCTTGTGGC. External right primer: GCTCACTTCAAAGTACGCCC. Internal left primer: TTCATTTTGTCTGAAAGGGAAA. Internal right primer: TGAGCCGATTGAAGAAATCC. Internal WT amplicon: 1198 bp. Deletion size: 465 bp. Deletion left flank: TTTGAAATATTTACTATAAGCCGGGTCGTC. Deletion right flank: TGGAAATATGAAAAAGGCACAAACCATATA. Insertion Sequence: TTTGATAAGAACCGTCGTAGTATGTTCTTCTGGTTTCTCTTCCACTGTTTCCTCCACGA TTTGTGAAGAGCTGGGATTCGATTCGTGAATTTCGTCTATTTCTGGTGTTGATGATGGT GTGGCGGTGGTTGATTTATCCTCCAAACCCAAACGTTGATTTATCCTCCAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2196 C. elegans T12G3.1(ok2892) IV. Show Description
T12G3.1. External left primer: AGGAAGAGTGTGCGCCTTTA. External right primer: AATTCAGCAGAGCTGGCTTC. Internal left primer: TGTCAACGGACCAATCTTTG. Internal right primer: CTTCTTGTTCAAGACGGGCT. Internal WT amplicon: 1199 bp. Deletion size: 795 bp. Deletion left flank: ATCAGTGAGCACTGAAACTGCCAAAAAAGC. Deletion right flank: AATGACCAAATTCGAAGAGAAAATGGATAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2197 C. elegans sma-6(ok2894) II. Show Description
C32D5.2. External left primer: GCGTTGATCCAAAGGACAGT. External right primer: CAACTTTACGCTGCGATTGA. Internal left primer: TCGCAAAGCTCTGTATCGTG. Internal right primer: TCGGGGTTTTTGATCAACTC. Internal WT amplicon: 1159 bp. Deletion size: 304 bp. Deletion left flank: GTGGGAAGTTGCAATCAGGGTTGAGGTATG. Deletion right flank: GAAAAACGTCCCAGCACTTAATGAATTGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2199 C. elegans rab-5(ok2605) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F26H9.6. Homozygous viable deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2605 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GTTGCTGAAAACCGTCACAA. External right primer: GCTCATTCACTGGCTGAACA. Internal left primer: TTGCGTTGATTTCGAAGTTT. Internal right primer: TTCGAGGGGAAAACAATGAC. Internal WT amplicon: 1186 bp. Deletion size: 359 bp. Deletion left flank: GAAAGACGTAAAAACGTTAATAATTAAGAA. Deletion right flank: ATAAAAACATGTTAACAGAGTACTGAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2202 C. elegans T05G5.8(ok2864) III. Show Description
T05G5.8. External left primer: AGAGCAGCATCACAAGTGGA. External right primer: CTGGAAAAGGGGGACAAAAT. Internal left primer: CAACATCCTGAACTAAAACCTGG. Internal right primer: TATGTGTAGAGTGGCGGCTG. Internal WT amplicon: 1123 bp. Deletion size: 373 bp. Deletion left flank: CCAGGAACTCATTTAAAGTTTTCTCTTGAG. Deletion right flank: TTGCTGTTCGATGAACCATTTTACAAAGTT. Insertion Sequence: TATTTATAAATACATCCAAGAAAGTATCAAAAACACTCCAAATAGCTTTTTCGAATGAA A. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2204 C. elegans unc-122(ok2882) I. Show Description
F11C3.2. External left primer: CCCATTCACATTTTCAGGCT. External right primer: TGCCGCACACCAATAATAAA. Internal left primer: CCGGCGAAATAGGAAATGTA. Internal right primer: ACTTCCTGCGGAAGAAACCT. Internal WT amplicon: 1145 bp. Deletion size: 327 bp. Deletion left flank: TGATCACAAAAATCAAGAACTCTCAGAGAA. Deletion right flank: GAAAAAATGGTTCCTGTGCCAGTAGTGGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2206 C. elegans C33A12(ok2888) IV. Show Description
C33A12. External left primer: CGTTGAGAGCTCCACACAAG. External right primer: GAAATTGAGCACAAAAGGGG. Internal left primer: TGCATAACGGCTTCAGTCAT. Internal right primer: GCTAGCGAGCCTCTTACAGC. Internal WT amplicon: 1141 bp. Deletion size: 344 bp. Deletion left flank: TACCAAATGGGTGCAACTTTGTAATATAAT. Deletion right flank: CTAACTGACATGCCAAAAAATCTGCGCGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2209 C. elegans lgc-46(ok2949) III. Show Description
Y71D11A.5. External left primer: CCAGTTTCAGCTGTGTCGAA. External right primer: GTTTTGCACGTACTTCCACG. Internal left primer: AAACTAGGCTTGTTGGGGGT. Internal right primer: CGAAGCTAATAATGGTGCCAA. Internal WT amplicon: 1314 bp. Deletion size: 492 bp. Deletion left flank: TCCCGGGAGAGGTAGCCGACCCAGGCGAGT. Deletion right flank: AACTCCCACGAATTTCTAGATAAACTCACT. Insertion Sequence: CCCACGAATTTCTAGATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2210 C. elegans C12C8.2(ok2954) I. Show Description
C12C8.2. External left primer: GATGCGGAAATCCAACAACT. External right primer: TCAAATGCAATCATTCCAGC. Internal left primer: AATGAGATAGAAGGCGGTGC. Internal right primer: GCATATTGATGCTGTGGGTG. Internal WT amplicon: 1191 bp. Deletion size: 694 bp. Deletion left flank: CTGTTGACGTTGAAAAAGAAAAGGATTTTG. Deletion right flank: AGTTGTTACAGTATCATCTTATGATAATTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2216 C. elegans K10D2.4(ok2759) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
K10D2.4. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2759 homozygotes (sterile, no eggs). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ACAACAACCGCGATCTTTTC. External right primer: CATCAATGGTTGTACAGCGG. Internal left primer: AAATCTCAGCGGGAGTTTGA. Internal right primer: CCGGCCTGTAAGTTCAATGT. Internal WT amplicon: 1136 bp. Deletion size: 658 bp. Deletion left flank: TTAAAATCTCAGCGGGAGTTTGATCAAATT. Deletion right flank: CATTGGGAAAGACGAACCGAATAATAGGTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2218 C. elegans H19M22.3(ok2827)/sC1 [dpy-1(s2170)] III. Show Description
H19M22.3. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2827 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AATCCGTGACGCTTAAATGG. External right primer: ATAATTCAGTGCCCGAGAGC. Internal left primer: ATCTCCGACTACACCAGCGA. Internal right primer: AGCGTCCGTTGACTTGAGTT. Internal WT amplicon: 1135 bp. Deletion size: 538 bp. Deletion left flank: AGAAAAAAATCTAGCAGATTGCAAAATCTA. Deletion right flank: AGTGTGCAGTGAGCAGCTGCTGCGACAAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2229 C. elegans pfd-6(ok2785) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F21C3.5. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2785 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TGAATTTGTGGTTGGGGATT. External right primer: ATTTCAACGCTGCTGGAGAC. Internal left primer: ATGATGGCTGACTTTGAGCA. Internal right primer: TGCAAAGTTGGTTTTCACGA. Internal WT amplicon: 1193 bp. Deletion size: 286 bp. Deletion left flank: GATGTAATTAGCAATGACTTTTAACATAGA. Deletion right flank: TGTCTGAGATGCTGGCTTCCACTCGTTTGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2240 C. elegans acs-4(ok2872) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F37C12.7. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2872 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGTTTCAGGCAAATTGGGT. External right primer: TTCCTGTGCTCAAGTCGTTG. Internal left primer: ATGTTTGGGAACTCGACAGC. Internal right primer: ATCCTTGAACAACAGGGCAG. Internal WT amplicon: 1170 bp. Deletion size: 335 bp. Deletion left flank: CTGAAGACCCTGATTTATTTCGCTCCTGTG. Deletion right flank: AATTTTTATTGGATTTAAAACTCATTTTAC. Insertion Sequence: CGAAATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2245 C. elegans ZK1236.1(ok3023) III. Show Description
ZK1236.1. External left primer: TAATTGACCGTGTTCCAGCA. External right primer: TTGAGTCGTTCCATTCCTCC. Internal left primer: TATTTCGATCATTTTCGCGG. Internal right primer: CCACCAAAGTTTCCCTTCAA. Internal WT amplicon: 1179 bp. Deletion size: 508 bp. Deletion left flank: GGTTGGAGAGACACTTTTCGCTGAAACAAC. Deletion right flank: GATTCGACTCGTCTCGTGATCCTTTGGAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2253 C. elegans spe-17(ok2631) IV. Show Description
ZK617.3. External left primer: TGCTGCACCTAACAATCAGC. External right primer: CAAGCGAACAGCAGTCACAT. Internal left primer: GCTTGAATTTTTGACTGTGGC. Internal right primer: GTTGTCGAATTATTGCGGCT. Internal WT amplicon: 1167 bp. Deletion size: 557 bp. Deletion left flank: TTAGCTGAAGTATTGGAAAAATCTCAGAAA. Deletion right flank: TGGTTAGTATTCTGGATGTTTGAGTGAGTA. Insertion Sequence: AAAAAAATCAAAAAAATCTCAAAAAAAAAAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2254 C. elegans ZC395.10(ok2968) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
ZC395.10. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2968 homozygotes (early- to mid-larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTGCCCATGGAAACTGATT. External right primer: CAATGCCATTCGCACTTAAA. Internal left primer: GAAAAACGAATGCGGGATAA. Internal right primer: TCTTGCTTGTTATTGCCGTG. Internal WT amplicon: 1196 bp. Deletion size: 501 bp. Deletion left flank: ATCCGTTCGCCATTCCACCGCCAATTCCGG. Deletion right flank: TAATTCGAAAAGAGAACTAGACGGATACGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2255 C. elegans atp-2(ok3002) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C34E10.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok3002 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GCTGCCACCAAGGTTTGTAT. External right primer: CGGTAAGCTTGTCTTCCTCG. Internal left primer: AGGTCTCTGCCAAGGCTACA. Internal right primer: TTTGAACTCCACGAGCAATG. Internal WT amplicon: 1178 bp. Deletion size: 500 bp. Deletion left flank: CAAGGCTACAGCTGCTAACGCTTCCGGACG. Deletion right flank: GTTACTCTGTGTTCGCTGGAGTCGGAGAGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2258 C. elegans cbd-1(ok2913) IV. Show Description
H02I12.1. External left primer: AAACCAGTAGCCCTCCGTTT. External right primer: TGGATCTTTCCCATTCTTGC. Internal left primer: TGCAGCGATGATTCTGTCTT. Internal right primer: GTCGAGGGATGAAGAATGGA. Internal WT amplicon: 1127 bp. Deletion size: 646 bp. Deletion left flank: ACTACGCCGACGGTTGCAATGACGTATTCT. Deletion right flank: CGTATCTTGAGAATCCATTCTTCATCCCTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2261 C. elegans K10D6.2(ok2876) V. Show Description
K10D6.2. External left primer: TTGGAAGTGGGAAGGATGAG. External right primer: CCGAACTCGTCATCCAAAAT. Internal left primer: GCAATGGCTCCTCTCTTCTG. Internal right primer: CAACAACATTGACGAAGATGG. Internal WT amplicon: 1196 bp. Deletion size: 824 bp. Deletion left flank: CTGACGACGATCTTCGTATCTTCTGAAAAC. Deletion right flank: GTGATGTTCTGATTCTCCAGCAGCTCCATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2263 C. elegans Y47D3B.6(ok3027) III. Show Description
Y47D3B.6. External left primer: CCTCCAAACAAGGCAACATT. External right primer: TGATTTTTCTTGAAAGCCCG. Internal left primer: CCATTGCGATTCACACTCAG. Internal right primer: TTGGGTTTTGTTTTGGGG. Internal WT amplicon: 1120 bp. Deletion size: 558 bp. Deletion left flank: GATGATGGCTCCACCAGCACCACTCCCAGC. Deletion right flank: AGTCTGCCAGTGCGCCGGAGCCTACGAGCC. Insertion Sequence: CTCCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2270 C. elegans lap-1(ok2917) III. Show Description
ZK353.6. External left primer: GATGTGTGTGGTCAGCTCGT. External right primer: ACCAACGAGGATGCAGTTTT. Internal left primer: CGGGACAATTACTGTTTGAGC. Internal right primer: ATCTCTCAGAATCGGTCCGT. Internal WT amplicon: 1129 bp. Deletion size: 331 bp. Deletion left flank: ATTGAATTGAAGTTAAATATACTTTGCAAT. Deletion right flank: CCAGCCTTCAACAGTTCTTCCCCACGGATC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2272 C. elegans rsp-3(ok2927) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y111B2A.18. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2927 homozygotes (sterile with vulval blip). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGGGCTGATGAATACTTGGA. External right primer: CGTGGCACACTCATTTCTTG. Internal left primer: GGTTGTTTGAATTAAGGATAGGTGA. Internal right primer: TTGAAGGATTTTAGGCCCAG. Internal WT amplicon: 1226 bp. Deletion size: 632 bp. Deletion left flank: GTTTCAAAAATAGTAAAAACTCACCTCATG. Deletion right flank: ATTATTTGCAAAAAATCGGCGACTGAAGAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2285 C. elegans F59D12.1(gk1122) X. Show Description
F59D12.1. Identified by PCR, validated by CGH. External left primer: CTCACAAAAAGGGGCGAATA. External right primer: TACCCCTTACACTAACGGCG. Internal left primer: GGTTGTGTTCTATCCCGACG. Internal right primer: ATGAGTGCTTGGGACTTTGG. Internal WT amplicon: 937 bp. Deletion size: 585 bp. Deletion left flank: ACTAGGTTTTCTGTTTGTCACATTTTTCTT. Deletion right flank: CTTATTTGAATATAAACATTCAAGATTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2286 C. elegans jph-1(ok2823) I. Show Description
T22C1.7. External left primer: TGGAATGTGTGGTTGAAGGA. External right primer: GGTGATCCCTCTGGCTGTAA. Internal left primer: TTGTGAATTGATTGGTGTTTGA. Internal right primer: GGCCTTTCTGGTAGAGGAGG. Internal WT amplicon: 1144 bp. Deletion size: 637 bp. Deletion left flank: TTCGGCATCACATGATTGTGATACGCTTTT. Deletion right flank: AATTTCAAAAATTTCCCTCATAATTTCAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2289 C. elegans +/szT1 [lon-2(e678)] I; unc-7(ok2826)/szT1 X. Show Description
R07D5.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok2826 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TCAATTTTCGACCAATGCAA. External right primer: TTACAAACGGCGAATCACCT. Internal left primer: CAAAGCCTAAGCCGAACACT. Internal right primer: TCTTGCAACAACAGTTTCTCAAA. Internal WT amplicon: 1136 bp. Deletion size: 591 bp. Deletion left flank: CCAAAACCAGAGGAATAAGAAAATTTTCTC. Deletion right flank: TATGTAAATGAAAATTTGAGAAACTGTTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2290 C. elegans W09C5.8(ok2908)/hIn1 [unc-101(sy241)] I. Show Description
W09C5.8. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2908 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: TTCCTCGCTACTACCCGCTA. External right primer: CCCGTGTGTTCTGTTGTTTG. Internal left primer: CAGCCCATCTCTCAAGAAGC. Internal right primer: TCCTCTTCCACGTTTCCATC. Internal WT amplicon: 1106 bp. Deletion size: 565 bp. Deletion left flank: CCTTCTCGAGCACAAGCGCACGCTCAACCT. Deletion right flank: AATAAATAACTGGTTTATGGGTTGAAAATG. Insertion Sequence: CAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807